# fasta34 -Q -H -E 10 -m 9 -b 1 -d 1 -r 15/-10 -g -12 -n -U ../testfiles/NAC_miRNA.fasta ../databases/cotton/CGI8.fasta
FASTA searches a protein or DNA sequence data bank
 version 3.4t25 Sept 2, 2005
Please cite:
 W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448

Query library ../testfiles/NAC_miRNA.fasta vs ../databases/cotton/CGI8.fasta library
searching ../databases/cotton/CGI8.fasta library

  1>>>total:39860_L:12096_-3:12346_0:617_+3:14801 - 22 nt (forward-only)
 vs  ../databases/cotton/CGI8.fasta library

43526801 residues in 55673 sequences
  Expectation_n fit: rho(ln(x))= 23.6457+/-0.000561; mu= -11.6380+/- 0.037
 mean_var=607.0983+/-151.124, 0's: 0 Z-trim: 2  B-trim: 0 in 0/43
 Lambda= 0.052053

FASTA (3.47 Mar 2004) function [optimized, 15/-10 matrix (15:-10)] ktup: 2
 join: 213, opt: 198, open/ext: -12/-12, width:  16
 Scan time:  2.700
The best scores are:                                      opt bits E(55673)	%_id  %_sim   bs  alen  an0  ax0  pn0  px0  an1  ax1 pn1 px1 gapq gapl  fs 
BE054209 similar to PRF|NP_974632.1|42573071|N ( 510) [f]  286  25.6      19	0.762 0.952  286   21    1   21    1   22  471  491    1  510   0   0   0

>>>total:39860_L:12096_-3:12346_0:617_+3:14801, 22 nt vs ../databases/cotton/CGI8.fasta library

>>BE054209 similar to PRF|NP_974632.1|42573071|NP_974632 pfkB-type carbohydrate kinase family pr  (510 nt)
 initn: 286 init1: 286 opt: 286  Z-score: 111.0  bits: 25.6 E():   19
banded Smith-Waterman score: 286;  76.190% identity (95.238% similar) in 21 nt overlap (1-21:471-491)

                                             10        20                    
total:                               UUGGACAGAGUAAUCACGGUCG                  
                                     :::::..:::::: .:.::::                   
BE0542 GAACUNUCUCAGUCAAGUUUAUUAUCUGCAUUGGAUGGAGUAAAUAUGGUCUACUUUGAUGGAAGACAUC
              450       460       470       480       490       500       510



22 residues in 1 query   sequences
43526801 residues in 55673 library sequences
 Scomplib [34t25]
 start: Sat Mar 22 16:31:47 2008 done: Sat Mar 22 16:31:49 2008
 Total Scan time:  2.700 Total Display time:  0.000

Function used was FASTA [version 3.4t25 Sept 2, 2005]