LICENSE
See the NOTICE file distributed with this work for additional information regarding copyright ownership.
Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License.
CONTACT
Please email comments or questions to the public Ensembl
developers list at <dev@ensembl.org>.
Questions may also be sent to the Ensembl help desk at
<helpdesk@ensembl.org>.
NAME
Bio::EnsEMBL::DBSQL::SequenceAdaptor - produce sequence strings from locations
SYNOPSIS
my $sa = $registry->get_adaptor( 'Human', 'Core', 'Sequence' );
my $dna =
${ $sa->fetch_by_Slice_start_end_strand( $slice, 1, 1000, -1 ) };
DESCRIPTION
An adaptor for the retrieval of DNA sequence from the EnsEMBL database
METHODS
new
Arg [1] : none
Example : my $sa = $db_adaptor->get_SequenceAdaptor();
Description: Constructor. Calls superclass constructor and initialises
internal cache structure.
Returntype : Bio::EnsEMBL::DBSQL::SequenceAdaptor
Exceptions : none
Caller : DBAdaptor::get_SequenceAdaptor
Status : Stable
fetch_by_Slice_start_end_strand
Arg [1] : Bio::EnsEMBL::Slice slice
The slice from which you want the sequence
Arg [2] : (optional) int startBasePair
The start base pair relative to the start of the slice. Negative
values or values greater than the length of the slice are fine.
default = 1
Arg [3] : (optional) int endBasePair
The end base pair relative to the start of the slice. Negative
values or values greater than the length of the slice are fine,
but the end must be greater than or equal to the start
count from 1
default = the length of the slice
Arg [4] : (optional) int strand
1, -1
default = 1
Example : $dna = $seq_adptr->fetch_by_Slice_start_end_strand($slice, 1,
1000, -1);
Description: Retrieves from db the sequence for this slice
uses AssemblyMapper to find the assembly
Returntype : string
Exceptions : endBasePair should be less or equal to length of slice
Caller : Bio::EnsEMBL::Slice::seq(), Slice::subseq()
Status : Stable
can_access_Slice
Description : Returns 1 since we can access any Slice's data
_rna_edit
Description : Performs within sequence region editting when
the underlying sequence is incorrect. Used by LRGs.
_fetch_raw_seq
Description : Communicates with the database to fetch back sequence
store
Arg [1] : int $seq_region_id the id of the sequence region this dna
will be associated with.
Arg [2] : string $sequence the dna sequence to be stored
in the database. Note that the sequence passed in will be
converted to uppercase.
Example : $seq_adaptor->store(11, 'ACTGGGTACCAAACAAACACAACA');
Description: stores a dna sequence in the databases dna table and returns the
database identifier for the new record.
Returntype : none
Exceptions : throw if the database insert fails
Caller : sequence loading scripts
Status : Stable
remove
Arg [1] : int $seq_region_id the id of the sequence region this dna
is associated with.
Example : $seq_adaptor->remove(11);
Description: removes a dna sequence for a given seq_region_id
Returntype : none
Exceptions : throw if the database delete fails
Caller : Internal
Status : Stable
_populate_seq_region_edits
Description: Query the database for any _rna_edit attributes attached to a seq region