/ 
bioperl-1.0.2
/ Bio::Perl

NAME

Bio::Perl - Functional access to BioPerl for people who don't know objects

SYNOPSIS

use Bio::Perl qw(read_sequence read_all_sequences write_sequence new_sequence get_sequence);

# will guess file format from extension $seq_object = read_sequence($filename);

# forces genbank format $seq_object = read_sequence($filename,'genbank');

# reads an array of sequences @seq_object_array = read_all_sequences($filename,'fasta');

# sequences are Bio::Seq objects, so the following methods work # for more info see Bio::Seq, or do 'perldoc Bio/Seq.pm'

print "Sequence name is ",$seq_object->display_id,"\n";
print "Sequence acc  is ",$seq_object->accession_number,"\n";
print "First 5 bases is ",$seq_object->subseq(1,5),"\n";

# get the whole sequence as a single string

$sequence_as_a_string = $seq_object->seq();

# writing sequences

write_sequence(">$filename",'genbank',$seq_object);

write_sequence(">$filename",'genbank',@seq_object_array);

# making a new sequence from just strings you have # from something else

$seq_object = new_sequence("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA","myname","AL12232");

# getting a sequence from a database (assumes internet connection)

$seq_object = get_sequence('swissprot',"ROA1_HUMAN");

$seq_object = get_sequence('embl',"AI129902");

$seq_object = get_sequence('genbank',"AI129902");

DESCRIPTION

Easy first time access to BioPerl via functions

FEEDBACK

Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.

bioperl-l@bio.perl.org

Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via email or the web:

bioperl-bugs@bio.perl.org
http://bio.perl.org/bioperl-bugs/

AUTHOR - Ewan Birney

Email bioperl-l@bio.perl.org

Describe contact details here

APPENDIX

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

read_sequence

Title   : read_sequence
Usage   : $seq = read_sequence('sequences.fa')
          $seq = read_sequence($filename,'genbank');

          # pipes are fine
          $seq = read_sequence("my_fetching_program $id |",'fasta');

Function: Reads the top sequence from the file. If no format is given, it will
          try to guess the format from the filename. If a format is given, it
          forces that format. The filename can be any valid perl open() string
          - in particular, you can put in pipes

Returns : A Bio::Seq object. A quick synopsis:
          $seq_object->display_id - name of the sequence
          $seq_object->seq        - sequence as a string

Args    : Two strings, first the filename - any Perl open() string is ok
          Second string is the format, which is optional

For more information on Seq objects see Bio::Seq.

read_all_sequences

Title   : read_all_sequences
Usage   : @seq_object_array = read_all_sequences($filename);
          @seq_object_array = read_all_sequences($filename,'genbank');

Function: Just as the function above, but reads all the sequences in the
          file and loads them into an array.

          For very large files, you will run out of memory. When this
          happens, you've got to use the SeqIO system directly (this is
          not so hard! Don't worry about it!).

Returns : array of Bio::Seq objects

Args    : two strings, first the filename (any open() string is ok)
          second the format (which is optional)

See Bio::SeqIO and Bio::Seq for more information

write_sequence

Title   : write_sequence
Usage   : write_sequence(">new_file.gb",'genbank',$seq)
          write_sequence(">new_file.gb",'genbank',@array_of_sequence_objects)

Function: writes sequences in the specified format

Returns : true

Args    : filename as a string, must provide an open() output file
          format as a string
          one or more sequence objects

new_sequence

Title   : new_sequence
Usage   :
Function:
Example :
Returns : 
Args    :

get_sequence

Title   : get_sequence
Usage   : $seq_object = get_sequence('swiss',"ROA1_HUMAN");

Function: If the computer has Internet accessibility, gets
          the sequence from Internet accessible databases. Currently
          this supports Swissprot, EMBL, GenBank and RefSeq.

          Swissprot and EMBL are more robust than GenBank fetching.

          If the user is trying to retrieve a RefSeq entry from
          GenBank/EMBL, the query is silently redirected.

Returns : A Bio::Seq object

Args    : database type - one of swiss, embl, genbank or refseq
          identifier or accession number