The Perl and Raku Conference 2025: Greenville, South Carolina - June 27-29 Learn more

#
# BioPerl module for Bio::SeqFeature::SubSeq
#
# Please direct questions and support issues to <bioperl-l@bioperl.org>
#
# Copyright Florent Angly
#
# You may distribute this module under the same terms as perl itself
=head1 NAME
Bio::SeqFeature::SubSeq - Feature representing a subsequence
=head1 SYNOPSIS
# SubSeq with implicit sequence
use Bio::Seq;
my $template = Bio::Seq->new( -seq => 'AAAAACCCCCGGGGGTTTTT' );
$subseq = Bio::SeqFeature::Amplicon->new(
-start => 6,
-end => 15,
-template => $template,
);
print "Subsequence is: ".$amplicon->seq->seq."\n"; # Should be 'CCCCCGGGGG'
# SubSeq with explicit sequence
use Bio::SeqFeature::Subseq;
my $subseq = Bio::SeqFeature::Amplicon->new(
-seq => $seq_object,
);
=head1 DESCRIPTION
Bio::SeqFeature::SubSeq extends L<Bio::SeqFeature::Generic> features to
represent a subsequence. When this feature is attached to a template sequence,
the sequence of feature is the subsequence of the template at this location. The
purpose of this class is to represent a sequence as a feature without having to
explicitly store its sequence string.
Of course, you might have reasons to explicitly set a sequence. In that case,
note that the length of the sequence is allowed to not match the position of the
feature. For example, you can set sequence of length 10 in a SubSeq feature that
spans positions 30 to 50 of the template if you so desire.
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
=head2 Support
Please direct usage questions or support issues to the mailing list:
I<bioperl-l@bioperl.org>
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via
the web:
=head1 AUTHOR
Florent Angly <florent.angly@gmail.com>
=head1 APPENDIX
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _
=cut
$Bio::SeqFeature::SubSeq::VERSION = '1.7.8';
use strict;
=head2 new
Title : new()
Usage : my $subseq = Bio::SeqFeature::SubSeq( -start => 1, -end => 10, -strand => -1);
Function: Instantiate a new Bio::SeqFeature::SubSeq feature object
Args : -seq , the sequence object or sequence string of the feature (optional)
-template , attach the feature to the provided parent template sequence or feature (optional).
Note that you must specify the feature location to do this.
-start, -end, -location, -strand and all other L<Bio::SeqFeature::Generic> argument can be used.
Returns : A Bio::SeqFeature::SubSeq object
=cut
sub new {
my ($class, @args) = @_;
my $self = $class->SUPER::new(@args);
my ($seq, $template) = $self->_rearrange([qw(SEQ TEMPLATE)], @args);
if (defined $seq) {
# Set the subsequence explicitly
if (not ref $seq) {
# Convert string to sequence object
$seq = Bio::PrimarySeq->new( -seq => $seq );
} else {
# Sanity check
if (not $seq->isa('Bio::PrimarySeqI')) {
$self->throw("Expected a sequence object but got a '".ref($seq)."'\n");
}
}
$self->seq($seq);
}
if ($template) {
if ( not($self->start) || not($self->end) ) {
$self->throw('Could not attach feature to template $template because'.
' the feature location was not specified.');
}
# Need to attach to parent sequence and then add sequence feature
my $template_seq;
if ($template->isa('Bio::SeqFeature::Generic')) {
$template_seq = $template->entire_seq;
} elsif ($template->isa('Bio::SeqI')) {
$template_seq = $template;
} else {
$self->throw("Expected a Bio::SeqFeature::Generic or Bio::SeqI object".
" as template, but got '$template'.");
}
$self->attach_seq($template_seq);
$template->add_SeqFeature($self);
}
return $self;
}
=head2 seq
Title : seq()
Usage : my $seq = $subseq->seq();
Function: Get or set the sequence object of this SubSeq feature. If no sequence
was provided, but the subseq is attached to a sequence, get the
corresponding subsequence.
Returns : A sequence object or undef
Args : None.
=cut
sub seq {
my ($self, $value) = @_;
if (defined $value) {
# The sequence is explicit
if ( not(ref $value) || not $value->isa('Bio::PrimarySeqI') ) {
$self->throw("Expected a sequence object but got a '".ref($value)."'\n");
}
$self->{seq} = $value;
}
my $seq = $self->{seq};
if (not defined $seq) {
# The sequence is implied
$seq = $self->SUPER::seq;
}
return $seq;
}
=head2 length
Title : seq()
Usage : my $length = $subseq->seq();
Function: Get the length of the SubSeq feature. It is similar to the length()
method of L<Bio::Generic::SeqFeature>, which computes length based
on the location of the feature. However, if the feature was not
given a location, return the length of the subsequence if possible.
Returns : integer or undef
Args : None.
=cut
sub length {
my ($self) = @_;
# Try length from location first
if ($self->start && $self->end) {
return $self->SUPER::length();
}
# Then try length from subsequence
my $seq = $self->seq;
if (defined $seq) {
return length $seq->seq;
}
# We failed
return undef;
}
1;