There is an ongoing outage on the primary CPAN mirror. It is possible to work around the issue by using MetaCPAN as a mirror.

NAME

Bio::Tools::Run::StandAloneWUBlast - Object for the local execution of WU-Blast.

SYNOPSIS

# Do not use directly; use Bio::Tools::Run::StandAloneBlast

DESCRIPTION

See Bio::Tools::Run::StandAloneBlast

FEEDBACK

Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.

bioperl-l@bioperl.org                  - General discussion
http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

Support

Please direct usage questions or support issues to the mailing list:

bioperl-l@bioperl.org

rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible.

Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:

https://github.com/bioperl/bioperl-live/issues

AUTHOR - Peter Schattner

Email schattner at alum.mit.edu

MAINTAINER - Torsten Seemann

Email torsten at infotech.monash.edu.au

CONTRIBUTORS

Sendu Bala bix@sendu.me.uk (reimplementation)

APPENDIX

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

new

Title   : new
Usage   : my $obj = Bio::Tools::Run::StandAloneBlast->new();
Function: Builds a newBio::Tools::Run::StandAloneBlast object 
Returns : Bio::Tools::Run::StandAloneBlast
Args    : -quiet => boolean # make program execution quiet
          -_READMETHOD => 'BLAST' (default, synonym 'SearchIO') || 'blast_pull'
                          # the parsing method, case insensitive

Essentially all BLAST parameters can be set via StandAloneBlast.pm. Some of the most commonly used parameters are listed below. All parameters have defaults and are optional except for -p.

  -p Program Name [String] 
        Input should be one of "wublastp", "wublastn", "wublastx", 
        "wutblastn", or "wutblastx".
  -d  Database [String] default = nr
        The database specified must first be formatted with xdformat.
  -E  Expectation value (E) [Real] default = 10.0
  -o  BLAST report Output File [File Out]  Optional,
	    default = ./blastreport.out ; set by StandAloneBlast.pm		

wublast

 Title   : wublast
 Usage   :  $blast_report = $factory->wublast('t/testquery.fa');
	or
	       $input = Bio::Seq->new(-id=>"test query",
				      -seq=>"ACTACCCTTTAAATCAGTGGGGG");
	       $blast_report = $factory->wublast($input);
	or 
	      $seq_array_ref = \@seq_array;  # where @seq_array is an array of Bio::Seq objects
	      $blast_report = $factory->wublast(\@seq_array);
 Returns :  Reference to a Blast object 
 Args    : Name of a file or Bio::Seq object or an array of 
           Bio::Seq object containing the query sequence(s). 
           Throws an exception if argument is not either a string 
           (eg a filename) or a reference to a Bio::Seq object 
           (or to an array of Seq objects).  If argument is string, 
           throws exception if file corresponding to string name can 
           not be found.

_generic_local_wublast

Title   : _generic_local_wublast
Usage   :  internal function not called directly
Returns :  Blast object
Args    :   Reference to calling object and name of BLAST executable 

_runwublast

Title   :  _runwublast
Usage   :  Internal function, not to be called directly	
Function:   makes actual system call to WU-Blast program
Example :
Returns : Report Blast object
Args    : Reference to calling object, name of BLAST executable, 
          and parameter string for executable 

_setparams

Title   : _setparams
Usage   : Internal function, not to be called directly	
Function: Create parameter inputs for Blast program
Example :
Returns : parameter string to be passed to Blast 
Args    : Reference to calling object and name of BLAST executable