NAME

MCE::Relay - Extends Many-Core Engine with relay capabilities

VERSION

This document describes MCE::Relay version 1.902

SYNOPSIS

use MCE::Flow;

my $file = shift || \*STDIN;

## Line Count #######################################

mce_flow_f {
   max_workers => 4,
   use_slurpio => 1,
   init_relay  => 0,
},
sub {
   my ($mce, $slurp_ref, $chunk_id) = @_;
   my $line_count = ($$slurp_ref =~ tr/\n//);

   ## Receive and pass on updated information.
   my $lines_read = MCE::relay { $_ += $line_count };

}, $file;

my $total_lines = MCE->relay_final;

print {*STDERR} "$total_lines\n";

## Orderly Action ###################################

$| = 1; # Important, must flush output immediately.

mce_flow_f {
   max_workers => 2,
   use_slurpio => 1,
   init_relay  => 0,
},
sub {
   my ($mce, $slurp_ref, $chunk_id) = @_;

   ## The relay value is relayed and remains 0.
   ## Writes to STDOUT orderly.

   MCE->relay_lock;
   print $$slurp_ref;
   MCE->relay_unlock;

}, $file;

DESCRIPTION

This module enables workers to receive and pass on information orderly with zero involvement by the manager process while running. The module is loaded automatically when MCE option init_relay is specified.

All workers (belonging to task_id 0) must participate when relaying data.

Relaying is not meant for passing big data. The last worker will stall if exceeding the buffer size for the socket. Not exceeding 16 KiB - 7 is safe across all platforms.

API DOCUMENTATION

MCE::relay { code }
mce_relay { code } since 1.882
MCE->relay ( sub { code } )
$mce->relay ( sub { code } )

Relay is enabled by defining the init_relay option which takes a hash or array reference, or a scalar value. Relaying is orderly and driven by chunk_id when processing data, otherwise task_wid. Omitting the code block (e.g. MCE::relay) relays forward.

Below, relaying multiple values via a HASH reference.

use MCE::Flow max_workers => 4;

mce_flow {
   init_relay => { p => 0, e => 0 },
},
sub {
   my $wid = MCE->wid;
   my $pass = $wid % 3;  # simulate work
   my $errs = $wid % 2;

   ## relay (include the trailing semicolon)

   my %last_rpt = MCE::relay { $_->{p} += $pass; $_->{e} += $errs };

   MCE->print("$wid: passed $pass, errors $errs\n");

   return;
};

my %results = MCE->relay_final;

print "   passed $results{p}, errors $results{e} final\n\n";

-- Output

1: passed 1, errors 1
2: passed 2, errors 0
3: passed 0, errors 1
4: passed 1, errors 0
   passed 4, errors 2 final

Or multiple values via an ARRAY reference.

use MCE::Flow max_workers => 4;

mce_flow {
   init_relay => [ 0, 0 ],
},
sub {
   my $wid = MCE->wid;

   ## do work
   my $pass = $wid % 3;
   my $errs = $wid % 2;

   ## relay
   my @last_rpt = MCE::relay { $_->[0] += $pass; $_->[1] += $errs };

   MCE->print("$wid: passed $pass, errors $errs\n");

   return;
};

my ($pass, $errs) = MCE->relay_final;

print "   passed $pass, errors $errs final\n\n";

-- Output

1: passed 1, errors 1
2: passed 2, errors 0
3: passed 0, errors 1
4: passed 1, errors 0
   passed 4, errors 2 final

Or simply a scalar value.

use MCE::Flow max_workers => 4;

mce_flow {
   init_relay => 0,
},
sub {
   my $wid = MCE->wid;

   ## do work
   my $bytes_read = 1000 + ((MCE->wid % 3) * 3);

   ## relay
   my $last_offset = MCE::relay { $_ += $bytes_read };

   ## output
   MCE->print("$wid: $bytes_read\n");

   return;
};

my $total = MCE->relay_final;

print "   $total size\n\n";

-- Output

1: 1003
2: 1006
3: 1000
4: 1003
   4012 size
MCE->relay_final ( void )
$mce->relay_final ( void )

Call this method to obtain the final relay value(s) after running. See included example findnull.pl for another use case.

use MCE max_workers => 4;

my $mce = MCE->new(
   init_relay => [ 0, 100 ],       ## initial values (two counters)

   user_func => sub {
      my ($mce) = @_;

      ## do work
      my ($acc1, $acc2) = (10, 20);

      ## relay to next worker
      MCE::relay { $_->[0] += $acc1; $_->[1] += $acc2 };

      return;
   }
)->run;

my ($cnt1, $cnt2) = $mce->relay_final;

print "$cnt1 : $cnt2\n";

-- Output

40 : 180
MCE->relay_recv ( void )
$mce->relay_recv ( void )

Call this method to obtain the next relay value before relaying. This allows serial-code to be processed orderly between workers. The following is a parallel demonstration for the fasta-benchmark on the web.

# perl fasta.pl 25000000

# The Computer Language Benchmarks game
# https://benchmarksgame-team.pages.debian.net/benchmarksgame/
#
# contributed by Barry Walsh
# port of fasta.rb #6
#
# MCE::Flow version by Mario Roy
# requires MCE 1.807+
# requires MCE::Shared 1.806+

use strict;
use warnings;
use feature 'say';

use MCE::Flow;
use MCE::Shared;
use MCE::Candy;

use constant IM => 139968;
use constant IA => 3877;
use constant IC => 29573;

my $LAST = MCE::Shared->scalar( 42 );

my $alu =
   'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' .
   'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' .
   'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' .
   'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' .
   'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' .
   'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' .
   'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA';

my $iub = [
   [ 'a', 0.27 ], [ 'c', 0.12 ], [ 'g', 0.12 ],
   [ 't', 0.27 ], [ 'B', 0.02 ], [ 'D', 0.02 ],
   [ 'H', 0.02 ], [ 'K', 0.02 ], [ 'M', 0.02 ],
   [ 'N', 0.02 ], [ 'R', 0.02 ], [ 'S', 0.02 ],
   [ 'V', 0.02 ], [ 'W', 0.02 ], [ 'Y', 0.02 ]
];

my $homosapiens = [
   [ 'a', 0.3029549426680 ],
   [ 'c', 0.1979883004921 ],
   [ 'g', 0.1975473066391 ],
   [ 't', 0.3015094502008 ]
];

sub make_repeat_fasta {
   my ( $src, $n ) = @_;
   my $width = qr/(.{1,60})/;
   my $l     = length $src;
   my $s     = $src x ( ($n / $l) + 1 );
   substr( $s, $n, $l ) = '';

   while ( $s =~ m/$width/g ) { say $1 }
}

sub make_random_fasta {
   my ( $table, $n ) = @_;
   my $rand   = undef;
   my $width  = 60;
   my $prob   = 0.0;
   my $output = '';
   my ( $c1, $c2, $last );

   $_->[1] = ( $prob += $_->[1] ) for @$table;

   $c1  = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
   $c1 .= "\$output .= '$_->[0]', next if $_->[1] > \$rand;\n" for @$table;

   my $seq = MCE::Shared->sequence(
      { chunk_size => 2000, bounds_only => 1 },
      1, $n / $width
   );

   my $code1 = q{
      while ( 1 ) {
         # --------------------------------------------
         # Process code orderly between workers.
         # --------------------------------------------

         my $chunk_id = MCE->relay_recv;
         my ( $begin, $end ) = $seq->next;

         MCE->relay, last if ( !defined $begin );

         my $last = $LAST->get;
         my $temp = $last;

         # Pre-compute $LAST value for the next worker
         for ( 1 .. ( $end - $begin + 1 ) * $width ) {
            $temp = ( $temp * IA + IC ) % IM;
         }

         $LAST->set( $temp );

         # Increment chunk_id value
         MCE->relay( sub { $_ += 1 } );

         # --------------------------------------------
         # Also run code in parallel between workers.
         # --------------------------------------------

         for ( $begin .. $end ) {
            for ( 1 .. $width ) { !C! }
            $output .= "\n";
         }

         # --------------------------------------------
         # Display orderly.
         # --------------------------------------------

         MCE->gather( $chunk_id, $output );

         $output = '';
      }
   };

   $code1 =~ s/!C!/$c1/g;

   MCE::Flow->init(
      max_workers => 4, ## MCE::Util->get_ncpu || 4,
      gather      => MCE::Candy::out_iter_fh( \*STDOUT ),
      init_relay  => 1,
      use_threads => 0,
   );

   MCE::Flow->run( sub { eval $code1 } );
   MCE::Flow->finish;

   $last = $LAST->get;

   $c2  = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
   $c2 .= "print('$_->[0]'), next if $_->[1] > \$rand;\n" for @$table;

   my $code2 = q{
      if ( $n % $width != 0 ) {
         for ( 1 .. $n % $width ) { !C! }
         print "\n";
      }
   };

   $code2 =~ s/!C!/$c2/g;
   eval $code2;

   $LAST->set( $last );
}

my $n = $ARGV[0] || 27;

say ">ONE Homo sapiens alu";
make_repeat_fasta( $alu, $n * 2 );

say ">TWO IUB ambiguity codes";
make_random_fasta( $iub, $n * 3 );

say ">THREE Homo sapiens frequency";
make_random_fasta( $homosapiens, $n * 5 );
MCE->relay_lock ( void )
MCE->relay_unlock ( void )
$mce->relay_lock ( void )
$mce->relay_unlock ( void )

The relay_lock and relay_unlock methods, added to MCE 1.807, are aliases for relay_recv and relay respectively. Together, they allow one to perform an exclusive action prior to actual relaying of data.

Relaying is driven by chunk_id or task_wid when not processing input, as seen here.

MCE->new(
   max_workers => 8,
   init_relay => 0,
   user_func => sub {
      MCE->relay_lock;
      MCE->say("wid: ", MCE->task_wid);
      MCE->relay_unlock( sub {
         $_ += 2;
      });
   }
)->run;

MCE->say("sum: ", MCE->relay_final);

__END__

wid: 1
wid: 2
wid: 3
wid: 4
wid: 5
wid: 6
wid: 7
wid: 8
sum: 16

Described above, relay takes a code block and combines relay_lock and relay_unlock into a single call. To make this more interesting, I define init_relay to a hash containing two key-value pairs.

MCE->new(
   max_workers => 8,
   init_relay => { count => 0, total => 0 },
   user_func => sub {
      MCE->relay_lock;
      MCE->say("wid: ", MCE->task_wid);
      MCE->relay_unlock( sub {
         $_->{count} += 1;
         $_->{total} += 2;
      });
   }
)->run;

my %results = MCE->relay_final;

MCE->say("count: ", $results{count});
MCE->say("total: ", $results{total});

__END__

wid: 1
wid: 2
wid: 3
wid: 4
wid: 5
wid: 6
wid: 7
wid: 8
count: 8
total: 16

Below, user_func is taken from the cat.pl MCE example. Incrementing the count is done only when the -n switch is passed to the script. Otherwise, output is displaced orderly and not necessary to update the $_ value if exclusive locking is all you need.

user_func => sub {
   my ($mce, $chunk_ref, $chunk_id) = @_;

   if ($n_flag) {
      ## Relays the total lines read.

      my $output = ''; my $line_count = ($$chunk_ref =~ tr/\n//);
      my $lines_read = MCE::relay { $_ += $line_count };

      open my $fh, '<', $chunk_ref;
      $output .= sprintf "%6d\t%s", ++$lines_read, $_ while (<$fh>);
      close $fh;

      $output .= ":$chunk_id";
      MCE->do('display_chunk', $output);
   }
   else {
      ## The following is another way to have ordered output. Workers
      ## write directly to STDOUT exclusively without any involvement
      ## from the manager process. The statement(s) between relay_lock
      ## and relay_unlock run serially and most important orderly.

      MCE->relay_lock;      # alias for MCE->relay_recv
      print $$chunk_ref;    # ensure $| = 1 in script
      MCE->relay_unlock;    # alias for MCE->relay
   }

   return;
}

The following is a variant of the fasta-benchmark demonstration shown above. Here, workers write exclusively and orderly to STDOUT.

# perl fasta.pl 25000000

# The Computer Language Benchmarks game
# https://benchmarksgame-team.pages.debian.net/benchmarksgame/
#
# contributed by Barry Walsh
# port of fasta.rb #6
#
# MCE::Flow version by Mario Roy
# requires MCE 1.807+
# requires MCE::Shared 1.806+

use strict;
use warnings;
use feature 'say';

use MCE::Flow;
use MCE::Shared;

use constant IM => 139968;
use constant IA => 3877;
use constant IC => 29573;

my $LAST = MCE::Shared->scalar( 42 );

my $alu =
   'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' .
   'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' .
   'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' .
   'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' .
   'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' .
   'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' .
   'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA';

my $iub = [
   [ 'a', 0.27 ], [ 'c', 0.12 ], [ 'g', 0.12 ],
   [ 't', 0.27 ], [ 'B', 0.02 ], [ 'D', 0.02 ],
   [ 'H', 0.02 ], [ 'K', 0.02 ], [ 'M', 0.02 ],
   [ 'N', 0.02 ], [ 'R', 0.02 ], [ 'S', 0.02 ],
   [ 'V', 0.02 ], [ 'W', 0.02 ], [ 'Y', 0.02 ]
];

my $homosapiens = [
   [ 'a', 0.3029549426680 ],
   [ 'c', 0.1979883004921 ],
   [ 'g', 0.1975473066391 ],
   [ 't', 0.3015094502008 ]
];

sub make_repeat_fasta {
   my ( $src, $n ) = @_;
   my $width = qr/(.{1,60})/;
   my $l     = length $src;
   my $s     = $src x ( ($n / $l) + 1 );
   substr( $s, $n, $l ) = '';

   while ( $s =~ m/$width/g ) { say $1 }
}

sub make_random_fasta {
   my ( $table, $n ) = @_;
   my $rand   = undef;
   my $width  = 60;
   my $prob   = 0.0;
   my $output = '';
   my ( $c1, $c2, $last );

   $_->[1] = ( $prob += $_->[1] ) for @$table;

   $c1  = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
   $c1 .= "\$output .= '$_->[0]', next if $_->[1] > \$rand;\n" for @$table;

   my $seq = MCE::Shared->sequence(
      { chunk_size => 2000, bounds_only => 1 },
      1, $n / $width
   );

   my $code1 = q{
      $| = 1; # Important, must flush output immediately.

      while ( 1 ) {
         # --------------------------------------------
         # Process code orderly between workers.
         # --------------------------------------------

         MCE->relay_lock;

         my ( $begin, $end ) = $seq->next;
         print( $output ), $output = '' if ( length $output );

         MCE->relay_unlock, last if ( !defined $begin );

         my $last = $LAST->get;
         my $temp = $last;

         # Pre-compute $LAST value for the next worker
         for ( 1 .. ( $end - $begin + 1 ) * $width ) {
            $temp = ( $temp * IA + IC ) % IM;
         }

         $LAST->set( $temp );

         MCE->relay_unlock;

         # --------------------------------------------
         # Also run code in parallel.
         # --------------------------------------------

         for ( $begin .. $end ) {
            for ( 1 .. $width ) { !C! }
            $output .= "\n";
         }
      }
   };

   $code1 =~ s/!C!/$c1/g;

   MCE::Flow->init(
      max_workers => 4, ## MCE::Util->get_ncpu || 4,
      init_relay  => 0,
      use_threads => 0,
   );

   MCE::Flow->run( sub { eval $code1 } );
   MCE::Flow->finish;

   $last = $LAST->get;

   $c2  = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
   $c2 .= "print('$_->[0]'), next if $_->[1] > \$rand;\n" for @$table;

   my $code2 = q{
      if ( $n % $width != 0 ) {
         for ( 1 .. $n % $width ) { !C! }
         print "\n";
      }
   };

   $code2 =~ s/!C!/$c2/g;
   eval $code2;

   $LAST->set( $last );
}

my $n = $ARGV[0] || 27;

say ">ONE Homo sapiens alu";
make_repeat_fasta( $alu, $n * 2 );

say ">TWO IUB ambiguity codes";
make_random_fasta( $iub, $n * 3 );

say ">THREE Homo sapiens frequency";
make_random_fasta( $homosapiens, $n * 5 );

GATHER AND RELAY DEMONSTRATIONS

I received a request from John Martel to process a large flat file and expand each record to many records based on splitting out items in field 4 delimited by semicolons. Each row in the output is given a unique ID starting with one while preserving output order.

Input File, possibly larger than 500 GiB in size
foo|field2|field3|item1;item2;item3;item4;itemN|field5|field6|field7
bar|field2|field3|item1;item2;item3;item4;itemN|field5|field6|field7
baz|field2|field3|item1;item2;item3;item4;itemN|field5|field6|field7
...
Output File
000000000000001|item1|foo|field2|field3|field5|field6|field7
000000000000002|item2|foo|field2|field3|field5|field6|field7
000000000000003|item3|foo|field2|field3|field5|field6|field7
000000000000004|item4|foo|field2|field3|field5|field6|field7
000000000000005|itemN|foo|field2|field3|field5|field6|field7
000000000000006|item1|bar|field2|field3|field5|field6|field7
000000000000007|item2|bar|field2|field3|field5|field6|field7
000000000000008|item3|bar|field2|field3|field5|field6|field7
000000000000009|item4|bar|field2|field3|field5|field6|field7
000000000000010|itemN|bar|field2|field3|field5|field6|field7
000000000000011|item1|baz|field2|field3|field5|field6|field7
000000000000012|item2|baz|field2|field3|field5|field6|field7
000000000000013|item3|baz|field2|field3|field5|field6|field7
000000000000014|item4|baz|field2|field3|field5|field6|field7
000000000000015|itemN|baz|field2|field3|field5|field6|field7
...
Example One

This example configures a custom function for preserving output order. Unfortunately, the sprintf function alone involves extra CPU time causing the manager process to fall behind. Thus, workers may idle while waiting for the manager process to respond to the gather request.

use strict;
use warnings;

use MCE::Loop;

my $infile  = shift or die "Usage: $0 infile\n";
my $newfile = 'output.dat';

open my $fh_out, '>', $newfile or die "open error $newfile: $!\n";

sub preserve_order {
    my ($fh) = @_;
    my ($order_id, $start_idx, $idx, %tmp) = (1, 1);

    return sub {
        my ($chunk_id, $aref) = @_;
        $tmp{ $chunk_id } = $aref;

        while ( my $aref = delete $tmp{ $order_id } ) {
            foreach my $line ( @{ $aref } ) {
                $idx = sprintf "%015d", $start_idx++;
                print $fh $idx, $line;
            }
            $order_id++;
        }
    }
}

MCE::Loop->init(
    chunk_size => 'auto', max_workers => 3,
    gather => preserve_order($fh_out)
);

mce_loop_f {
    my ($mce, $chunk_ref, $chunk_id) = @_;
    my @buf;

    foreach my $line (@{ $chunk_ref }) {
        $line =~ s/\r//g; chomp $line;

        my ($f1,$f2,$f3,$items,$f5,$f6,$f7) = split /\|/, $line;
        my @items_array = split /;/, $items;

        foreach my $item (@items_array) {
            push @buf, "|$item|$f1|$f2|$f3|$f5|$f6|$f7\n";
        }
    }

    MCE->gather($chunk_id, \@buf);

} $infile;

MCE::Loop->finish();
close $fh_out;
Example Two

In this example, workers obtain the current ID value and increment/relay for the next worker, ordered by chunk ID behind the scene. Workers call sprintf in parallel, allowing the manager process (out_iter_fh) to accommodate up to 32 workers and not fall behind.

Relay accounts for the worker handling the next chunk_id value. Therefore, do not call relay more than once per chunk. Doing so will cause IPC to stall.

use strict;
use warnings;

use MCE::Loop;
use MCE::Candy;

my $infile  = shift or die "Usage: $0 infile\n";
my $newfile = 'output.dat';

open my $fh_out, '>', $newfile or die "open error $newfile: $!\n";

MCE::Loop->init(
    chunk_size => 'auto', max_workers => 8,
    gather => MCE::Candy::out_iter_fh($fh_out),
    init_relay => 1
);

mce_loop_f {
    my ($mce, $chunk_ref, $chunk_id) = @_;
    my @lines;

    foreach my $line (@{ $chunk_ref }) {
        $line =~ s/\r//g; chomp $line;

        my ($f1,$f2,$f3,$items,$f5,$f6,$f7) = split /\|/, $line;
        my @items_array = split /;/, $items;

        foreach my $item (@items_array) {
            push @lines, "$item|$f1|$f2|$f3|$f5|$f6|$f7\n";
        }
    }

    my $idx = MCE::relay { $_ += scalar @lines };
    my $buf = '';

    foreach my $line ( @lines ) {
        $buf .= sprintf "%015d|%s", $idx++, $line
    }

    MCE->gather($chunk_id, $buf);

} $infile;

MCE::Loop->finish();
close $fh_out;

INDEX

MCE, MCE::Core

AUTHOR

Mario E. Roy, <marioeroy AT gmail DOT com>