LICENSE

Copyright [1999-2015] Wellcome Trust Sanger Institute and the EMBL-European Bioinformatics Institute Copyright [2016-2024] EMBL-European Bioinformatics Institute

Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at

     http://www.apache.org/licenses/LICENSE-2.0

Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License.

CONTACT

  Please email comments or questions to the public Ensembl
  developers list at <dev@ensembl.org>.

  Questions may also be sent to the Ensembl help desk at
  <helpdesk@ensembl.org>.

NAME

Bio::EnsEMBL::DBSQL::SequenceAdaptor - produce sequence strings from locations

SYNOPSIS

  my $sa = $registry->get_adaptor( 'Human', 'Core', 'Sequence' );

  my $dna =
    ${ $sa->fetch_by_Slice_start_end_strand( $slice, 1, 1000, -1 ) };

DESCRIPTION

An adaptor for the retrieval of DNA sequence from the EnsEMBL database

METHODS

new

  Arg [1]    : none
  Example    : my $sa = $db_adaptor->get_SequenceAdaptor();
  Description: Constructor. Calls superclass constructor and initialises
               internal cache structure.
  Returntype : Bio::EnsEMBL::DBSQL::SequenceAdaptor
  Exceptions : none
  Caller     : DBAdaptor::get_SequenceAdaptor
  Status     : Stable

fetch_by_Slice_start_end_strand

  Arg  [1]   : Bio::EnsEMBL::Slice slice
               The slice from which you want the sequence
  Arg  [2]   : (optional) int startBasePair 
               The start base pair relative to the start of the slice. Negative
               values or values greater than the length of the slice are fine.
               default = 1
  Arg  [3]   : (optional) int endBasePair
               The end base pair relative to the start of the slice. Negative
               values or values greater than the length of the slice are fine,
               but the end must be greater than or equal to the start
               count from 1
               default = the length of the slice
  Arg  [4]   : (optional) int strand 
               1, -1
               default = 1
  Example    : $dna = $seq_adptr->fetch_by_Slice_start_end_strand($slice, 1, 
                                                                  1000, -1);
  Description: Retrieves from db the sequence for this slice
               uses AssemblyMapper to find the assembly
  Returntype : string 
  Exceptions : endBasePair should be less or equal to length of slice 
  Caller     : Bio::EnsEMBL::Slice::seq(), Slice::subseq() 
  Status     : Stable

can_access_Slice

  Description : Returns 1 since we can access any Slice's data

_rna_edit

  Description : Performs within sequence region editting when 
                the underlying sequence is incorrect. Used by LRGs.

_fetch_raw_seq

  Description : Communicates with the database to fetch back sequence

store

  Arg [1]    : int $seq_region_id the id of the sequence region this dna
               will be associated with.
  Arg [2]    : string $sequence the dna sequence to be stored 
               in the database.  Note that the sequence passed in will be
               converted to uppercase.
  Example    : $seq_adaptor->store(11, 'ACTGGGTACCAAACAAACACAACA');
  Description: stores a dna sequence in the databases dna table and returns the
               database identifier for the new record.
  Returntype : none
  Exceptions : throw if the database insert fails
  Caller     : sequence loading scripts
  Status     : Stable

remove

  Arg [1]    : int $seq_region_id the id of the sequence region this dna   
               is associated with.   
  Example    : $seq_adaptor->remove(11);   
  Description: removes a dna sequence for a given seq_region_id    
  Returntype : none    
  Exceptions : throw if the database delete fails    
  Caller     : Internal    
  Status     : Stable    
   

_populate_seq_region_edits

  Description:  Query the database for any _rna_edit attributes attached to a seq region