LICENSE
Copyright [1999-2015] Wellcome Trust Sanger Institute and the EMBL-European Bioinformatics Institute Copyright [2016-2024] EMBL-European Bioinformatics Institute
Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License.
CONTACT
Please email comments or questions to the public Ensembl
developers list at <http://lists.ensembl.org/mailman/listinfo/dev>.
Questions may also be sent to the Ensembl help desk at
<http://www.ensembl.org/Help/Contact>.
NAME
Bio::EnsEMBL::Utils::Sequence - Utility functions for sequences
SYNOPSIS
use Bio::EnsEMBL::Utils::Sequence qw(reverse_comp expand);
my $seq = 'ACTTTAAAGGCTATCCCAATATG';
print "my sequence = $seq\n";
reverse_comp( \$seq );
print "my reverse comp = $seq\n";
my $compressed_seq = '(AC)3';
print "my expanded seq is = expand($compressed_seq)";
METHODS
reverse_comp
Arg [1] : reference to a string $seqref
Example : use Bio::EnsEMBL::Utils::Sequence qw(reverse_comp);
$seq = 'ACCTGAA';
reverse_comp(\$seq);
print $seq;
Description: Does an in place reverse compliment of a passed in string
reference. The string is passed by reference
rather than by value for memory efficiency.
Returntype : none
Exceptions : none
Caller : SequenceAdaptor, SliceAdaptor
expand
Arg [1] : reference to a string $seqref
Example : use Bio::EnsEMBL::Utils::Sequence qw(expand);
$seq = '(AC)3';
expand(\$seq);
print $seq;
Description: Expands a genomic sequence. The string is passed by reference
rather than by value for memory efficiency.
Returntype : none
Exceptions : none
Caller : SequenceAdaptor, SliceAdaptor