/ 
bioperl-1.0.2
/ Bio::Map::Microsatellite

NAME

Bio::Map::Microsatellite - An object representing a Microsatellite marker.

SYNOPSIS

$o_usat = new Bio::Map::Microsatellite
    (-name=>'Chad Super Marker 2',
     -sequence => 'gctgactgatcatatatatatatatatatatatatatatatcgcgatcgtga',
     -motif => 'at',
     -repeats => 15,
     -repeat_start_position => 11
     );

$sequence_before_usat = $o_usat->get_leading_flank();
$sequence_after_usat = $o_usat->get_trailing_flank();

DESCRIPTION

This object handles the notion of an Microsatellite. This microsatellite can be placed on a (linear) Map or used on its own. If this Microsatellites will be used in a mapping context (it doesn't have to, you know) it can have multiple positions in a map. For information about a Microsatellite's position in a map one must query the associate PositionI object which is accessible through the position() method.

FEEDBACK

Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to the Bioperl mailing list. Your participation is much appreciated.

bioperl-l@bioperl.org              - General discussion
http://bioperl.org/MailList.shtml  - About the mailing lists

Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track of the bugs and their resolution. Bug reports can be submitted via email or the web:

bioperl-bugs@bioperl.org
http://bioperl.org/bioperl-bugs/

AUTHOR - Chad Matsalla

Email bioinformatics1@dieselwurks.com

CONTRIBUTORS

Heikki Lehvaslaiho heikki@ebi.ac.uk Lincoln Stein lstein@cshl.org Jason Stajich jason@bioperl.org

APPENDIX

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

new

 Title   : new
 Usage   : $o_usat = 
 Function: Builds a new Bio::Map::Microsatellite object
 Returns : Bio::Map::Microsatellite
 Args    :
	-name    => name of this microsatellite (optional, string,
		default 'Unknown microsatellite')
        -positions => position(s) for this marker in maps[optional],
                An array reference of tuples (array refs themselves)
                Each tuple conatins a Bio::Map::MapI-inherited object and a 
		Bio::Map::PositionI-inherited obj, no default)
	-sequence => the sequence of this microsatellite (optional,
		 scalar, no default)
	-motif => the repeat motif of this microsatellite (optional,
		 scalar, no default)
	-repeats => the number of motif repeats for this microsatellite
		(optional, scalar, no default)
	-repeat_start_position => the starting position of the
		microsatellite in this sequence. The first base of the
		sequence is position "1". (optional, scalar, no default)

 Note    : Creating a Bio::Map::Microsatellite object with no position
	might be useful for microsatellite people wanting to embrace
	and extend this module. <raising hand> Me! Me! Me!
	- using repeat_start_position will trigger a mechinism to
	calculate a value for repeat_end_position.

Bio::Map::Marker methods

position

Title   : position
Usage   : my $position = $mappable->position($map); OR
          $mappable->position($map,$position); OR
Function: Get/Set the Bio::Map::PositionI for a mappable element
          in a specific Map
Returns : Bio::Map::PositionI
Args    : $map =Bio::Map::MapI # Map we are talking about
          $position = Bio::Map::PositionI # Position we want to set

name($new_name)

 Title   : name($new_name)
 Usage   : $o_usat->name($new_name) _or_
	   my $name = $o_usat->name()
 Function: Get/Set the name for this Microsatellite
 Returns : A scalar representing the current name of this Microsatellite
 Args    : If provided, the current name of this Microsatellite
	   will be set to $new_name.

motif($new_motif)

 Title   : motif($new_motif)
 Usage   : my $motif = $o_usat->motif($new_motif) _or_
	my $motif = $o_usat->motif()
 Function: Get/Set the repeat motif for this Microsatellite
 Returns : A scalar representing the current repeat motif of this
	Microsatellite.
 Args    : If provided, the current repeat motif of this Microsatellite
	will be set to $new_motif.

sequence($new_sequence)

 Title   : sequence($new_sequence)
 Usage   : my $sequence = $o_usat->sequence($new_sequence) _or_
	my $sequence = $o_usat->sequence()
 Function: Get/Set the sequence for this Microsatellite
 Returns : A scalar representing the current sequence of this
	Microsatellite.
 Args    : If provided, the current sequence of this Microsatellite
	will be set to $new_sequence.

repeats($new_repeats)

 Title   : repeats($new_repeats)
 Usage   : my $repeats = $o_usat->repeats($new_repeats) _or_
	my $repeats = $o_usat->repeats()
 Function: Get/Set the repeat repeats for this Microsatellite
 Returns : A scalar representing the current number of repeats of this
	Microsatellite.
 Args    : If provided, the current number of repeats of this
	Microsatellite will be set to $new_repeats.

repeat_start_position($new_repeat_start_position)

 Title   : repeat_start_position($new_repeat_start_position)
 Usage   : my $repeat_start_position =
	$o_usat->repeat_start_position($new_repeat_start_position) _or_
	my $repeat_start_position = $o_usat->repeat_start_position()
 Function: Get/Set the repeat repeat_start_position for this
	Microsatellite
 Returns : A scalar representing the repeat start position for this 
	Microsatellite.
 Args    : If provided, the current repeat start position of this
	Microsatellite will be set to $new_repeat_start_position.
	This method will also try to set the repeat end position. This
	depends on having information for the motif and the number of
	repeats. If you want to use methods like get_trailing_flank or
	get_leading flank, be careful to include the right information.

repeat_end_position($value)

 Title   : repeat_end_position($set)
 Usage   : $new_repeat_end_position =
		$o_usat->repeat_end_position("set"); _or_
	$new_repeat_end_position =
		$o_usat->repeat_end_position($value); _or_
	$current_repeat_end_position = $o_usat->repeat_end_position();
 Function: get/set the end position of the repeat in this sequence
 Returns : A scalar representing the base index of the end of the
	repeat in this Microsatellite. The first base in the sequence
	is base 1.
 Args    : A scalar representing a value, the string "set", or no
	argument (see Notes).
 Notes   : If you do not provide an argument to this method, the current
	end position of the repeat in this Microsatellite will be
	returned (a scalar).
	If you provide the string "set" to this method it will set the
	end position based on the start position, the length of the
	motif, and the nuimber of repeats.
	If you specify a value the current end position of the repeat
	will be set to that value. This is a really bad idea. Don't do
	it.

equals

Title   : equals
Usage   : if( $mappable->equals($mapable2)) ...
Function: Test if a position is equal to another position
Returns : boolean
Args    : Bio::Map::MappableI

less_than

Title   : less_than
Usage   : if( $mappable->less_than($m2) ) ...
Function: Tests if a position is less than another position
Returns : boolean
Args    : Bio::Map::MappableI

greater_than

Title   : greater_than
Usage   : if( $mappable->greater_than($m2) ) ...
Function: Tests if position is greater than another position
Returns : boolean
Args    : Bio::Map::MappableI

get_leading_flank()

 Title   : get_leading_flank()
 Usage   : $leading_sequence = $o_usat->get_leading_flank();
 Returns : A scalar representing the sequence before the repeats in this
	Microsatellite.
 Args    : None.

get_trailing_flank()

 Title   : get_trailing_flank()
 Usage   : $trailing_flank = $o_usat->get_trailing_flank();
 Returns : A scalar representing the sequence after the repeats in this
	Microsatellite.
 Args    : None.