NAME
Bio::PrimarySeq - Bioperl lightweight Sequence Object
SYNOPSIS
# The Bio::SeqIO for file reading, Bio::DB::GenBank for
# database reading
use Bio::Seq;
use Bio::SeqIO;
use Bio::DB::GenBank;
#make from memory
$seqobj = Bio::PrimarySeq->new ( -seq => 'ATGGGGTGGGCGGTGGGTGGTTTG',
-id => 'GeneFragment-12',
-accession_number => 'X78121',
-alphabet => 'dna',
-is_circular => 1
);
print "Sequence ", $seqobj->id(), " with accession ",
$seqobj->accession_number, "\n";
# read from file
$inputstream = Bio::SeqIO->new(-file => "myseq.fa",-format => 'Fasta');
$seqobj = $inputstream->next_seq();
print "Sequence ", $seqobj->id(), " and desc ", $seqobj->desc, "\n";
# to get out parts of the sequence.
print "Sequence ", $seqobj->id(), " with accession ",
$seqobj->accession_number, " and desc ", $seqobj->desc, "\n";
$string = $seqobj->seq();
$string2 = $seqobj->subseq(1,40);
DESCRIPTION
PrimarySeq is a lightweight Sequence object, storing little more than the sequence, its name, a computer useful unique name. It does not contain sequence features or other information. To have a sequence with sequence features you should use the Seq object which uses this object - go perldoc Bio::Seq
Although newusers will use Bio::PrimarySeq alot, in general you will be using it from the Bio::Seq object. For more information on Bio::Seq go perldoc Bio::Seq. For interest you might like to known that Bio::Seq has-a Bio::PrimarySeq and forwards most of the function calls to do with sequence to it (the has-a relationship lets us get out of a otherwise nasty cyclical reference in Perl which would leak memory).
Sequence objects are defined by the Bio::PrimarySeqI interface, and this object is a pure Perl implementation of the interface (if that's gibberish to you, don't worry. The take home message is that this object is the bioperl default sequence object, but other people can use their own objects as sequences if they so wish). If you are interested in wrapping your own objects as compliant Bioperl sequence objects, then you should read the Bio::PrimarySeqI documentation
The documenation of this object is a merge of the Bio::PrimarySeq and Bio::PrimarySeqI documentation. This allows all the methods which you can call on sequence objects here.
FEEDBACK
Mailing Lists
User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bio.perl.org/MailList.html - About the mailing lists
Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via email or the web:
bioperl-bugs@bio.perl.org
http://bugzilla.bioperl.org/
AUTHOR - Ewan Birney
Email birney@sanger.ac.uk
Describe contact details here
APPENDIX
The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _
new
Title : new
Usage : $seq = Bio::PrimarySeq->new( -seq => 'ATGGGGGTGGTGGTACCCT',
-id => 'human_id',
-accession_number => 'AL000012',
);
Function: Returns a new primary seq object from
basic constructors, being a string for the sequence
and strings for id and accession_number.
Note that you can provide an empty sequence string. However, in
this case you MUST specify the type of sequence you wish to
initialize by the parameter -alphabet. See alphabet() for possible
values.
Returns : a new Bio::PrimarySeq object
Args : -seq => sequence string
-display_id => display id of the sequence (locus name)
-accession_number => accession number
-primary_id => primary id (Genbank id)
-namespace => the namespace for the accession
-authority => the authority for the namespace
-desc => description text
-alphabet => sequence type (alphabet) (dna|rna|protein)
-id => alias for display id
-is_circular => boolean field for whether or not sequence is circular
seq
Title : seq
Usage : $string = $obj->seq()
Function: Returns the sequence as a string of letters. The
case of the letters is left up to the implementer.
Suggested cases are upper case for proteins and lower case for
DNA sequence (IUPAC standard), but you should not rely on this
Returns : A scalar
Args : Optionally on set the new value (a string). An optional second
argument presets the alphabet (otherwise it will be guessed).
Both parameters may also be given in named paramater style
with -seq and -alphabet being the names.
validate_seq
Title : validate_seq
Usage : if(! $seq->validate_seq($seq_str) ) {
print "sequence $seq_str is not valid for an object of type ",
ref($seq), "\n";
}
Function: Validates a given sequence string. A validating sequence string
must be accepted by seq(). A string that does not validate will
lead to an exception if passed to seq().
The implementation provided here does not take alphabet() into
account. Allowed are all letters (A-Z) and '-','.', '*' and '?'.
Example :
Returns : 1 if the supplied sequence string is valid for the object, and
0 otherwise.
Args : The sequence string to be validated.
subseq
Title : subseq
Usage : $substring = $obj->subseq(10,40);
Function: returns the subseq from start to end, where the first base
is 1 and the number is inclusive, ie 1-2 are the first two
bases of the sequence
Returns : a string
Args : integer for start position
integer for end position
OR
Bio::LocationI location for subseq (strand honored)
length
Title : length
Usage : $len = $seq->length();
Function: Get the length of the sequence in number of symbols (bases
or amino acids).
You can also set this attribute, even to a number that does
not match the length of the sequence string. This is useful
if you don''t want to set the sequence too, or if you want
to free up memory by unsetting the sequence. In the latter
case you could do e.g.
$seq->length($seq->length);
$seq->seq(undef);
Note that if you set the sequence to a value other than
undef at any time, the length attribute will be
invalidated, and the length of the sequence string will be
reported again. Also, we won''t let you lie about the length.
Example :
Returns : integer representing the length of the sequence.
Args : Optionally, the value on set
display_id
Title : display_id or display_name
Usage : $id_string = $obj->display_id();
Function: returns the display id, aka the common name of the Sequence object.
The semantics of this is that it is the most likely string to
be used as an identifier of the sequence, and likely to have
"human" readability. The id is equivalent to the ID field of
the GenBank/EMBL databanks and the id field of the
Swissprot/sptrembl database. In fasta format, the >(\S+) is
presumed to be the id, though some people overload the id to
embed other information. Bioperl does not use any embedded
information in the ID field, and people are encouraged to use
other mechanisms (accession field for example, or extending
the sequence object) to solve this.
With the new Bio::DescribeableI interface, display_name aliases
to this method.
Returns : A string
Args : None
accession_number
Title : accession_number or object_id
Usage : $unique_key = $obj->accession_number;
Function: Returns the unique biological id for a sequence, commonly
called the accession_number. For sequences from established
databases, the implementors should try to use the correct
accession number. Notice that primary_id() provides the
unique id for the implemetation, allowing multiple objects
to have the same accession number in a particular implementation.
For sequences with no accession number, this method should
return "unknown".
[Note this method name is likely to change in 1.3]
With the new Bio::IdentifiableI interface, this is aliased
to object_id
Returns : A string
Args : A string (optional) for setting
primary_id
Title : primary_id
Usage : $unique_key = $obj->primary_id;
Function: Returns the unique id for this object in this
implementation. This allows implementations to manage their
own object ids in a way the implementaiton can control
clients can expect one id to map to one object.
For sequences with no natural primary id, this method
should return a stringified memory location.
Returns : A string
Args : A string (optional, for setting)
alphabet
Title : alphabet
Usage : if( $obj->alphabet eq 'dna' ) { /Do Something/ }
Function: Returns the type of sequence being one of
'dna', 'rna' or 'protein'. This is case sensitive.
This is not called <type> because this would cause
upgrade problems from the 0.5 and earlier Seq objects.
Returns : a string either 'dna','rna','protein'. NB - the object must
make a call of the type - if there is no type specified it
has to guess.
Args : none
desc
Title : desc or description
Usage : $obj->desc($newval)
Function: Get/set description of the sequence.
description is an alias for this for compliance with the
Bio::DescribeableI interface.
Example :
Returns : value of desc (a string)
Args : newvalue (a string or undef, optional)
can_call_new
Title : can_call_new
Usage :
Function:
Example :
Returns : true
Args :
id
Title : id
Usage : $id = $seq->id()
Function: This is mapped on display_id
Example :
Returns :
Args :
is_circular
Title : is_circular
Usage : if( $obj->is_circular) { /Do Something/ }
Function: Returns true if the molecule is circular
Returns : Boolean value
Args : none
Methods for Bio::IdentifiableI compliance
object_id
Title : object_id
Usage : $string = $obj->object_id()
Function: a string which represents the stable primary identifier
in this namespace of this object. For DNA sequences this
is its accession_number, similarly for protein sequences
This is aliased to accession_number().
Returns : A scalar
version
Title : version
Usage : $version = $obj->version()
Function: a number which differentiates between versions of
the same object. Higher numbers are considered to be
later and more relevant, but a single object described
the same identifier should represent the same concept
Returns : A number
authority
Title : authority
Usage : $authority = $obj->authority()
Function: a string which represents the organisation which
granted the namespace, written as the DNS name for
organisation (eg, wormbase.org)
Returns : A scalar
namespace
Title : namespace
Usage : $string = $obj->namespace()
Function: A string representing the name space this identifier
is valid in, often the database name or the name
describing the collection
Returns : A scalar
Methods for Bio::DescribableI compliance
This comprises of display_name and description.
display_name
Title : display_name
Usage : $string = $obj->display_name()
Function: A string which is what should be displayed to the user
the string should have no spaces (ideally, though a cautious
user of this interface would not assumme this) and should be
less than thirty characters (though again, double checking
this is a good idea)
This is aliased to display_id().
Returns : A scalar
description
Title : description
Usage : $string = $obj->description()
Function: A text string suitable for displaying to the user a
description. This string is likely to have spaces, but
should not have any newlines or formatting - just plain
text. The string should not be greater than 255 characters
and clients can feel justified at truncating strings at 255
characters for the purposes of display
This is aliased to desc().
Returns : A scalar
Methods Inherited from Bio::PrimarySeqI
These methods are available on Bio::PrimarySeq, although they are actually implemented on Bio::PrimarySeqI
revcom
Title : revcom
Usage : $rev = $seq->revcom()
Function: Produces a new Bio::SeqI implementing object which
is the reversed complement of the sequence. For protein
sequences this throws an exception of
"Sequence is a protein. Cannot revcom"
The id is the same id as the orginal sequence, and the
accession number is also indentical. If someone wants to
track that this sequence has be reversed, it needs to
define its own extensions
To do an inplace edit of an object you can go:
$seqobj = $seqobj->revcom();
This of course, causes Perl to handle the garbage
collection of the old object, but it is roughly speaking as
efficient as an inplace edit.
Returns : A new (fresh) Bio::SeqI object
Args : none
trunc
Title : trunc
Usage : $subseq = $myseq->trunc(10,100);
Function: Provides a truncation of a sequence,
Example :
Returns : a fresh Bio::SeqI implementing object
Args :
Internal methods
These are internal methods to PrimarySeq
_guess_alphabet
Title : _guess_alphabet
Usage :
Function:
Example :
Returns :
Args :