—
—
—
—
—
—
—

              
#
# This is the original copyright statement. I have relied on Chad's module
# extensively for this module.
#
# Copyright (c) 1997-2001 bioperl, Chad Matsalla. All Rights Reserved.
#           This module is free software; you can redistribute it and/or
#           modify it under the same terms as Perl itself. 
#
# Copyright Chad Matsalla
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
#
# But I have modified lots of it, so I guess I should add:
#
# Copyright (c) 2003 bioperl, Rob Edwards. All Rights Reserved.
#           This module is free software; you can redistribute it and/or
#           modify it under the same terms as Perl itself. 
#
# Copyright Rob Edwards
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
HideShow 165 lines of Pod
=head1 NAME
Bio::Seq::PrimedSeq - A sequence and a pair of primers matching on it
=head1 SYNOPSIS
  use Bio::Seq;
  use Bio::Seq::PrimedSeq;
  my $template = Bio::Seq->new( -seq => 'AGCTTTTCATTCTGACTGCAAC' );
  my $left     = Bio::Seq->new( -seq => 'AGCT' );
  my $right    = Bio::Seq->new( -seq => 'GTTGC' );
  my $primedseq = Bio::Seq::PrimedSeq->new(
          -seq          => $template,  # sequence object
          -left_primer  => $left,      # sequence or primer object
          -right_primer => $right      # sequence or primer object
  );
  # Get the primers as Bio::SeqFeature::Primer objects
  my @primer_objects = $primedseq->get_primer();
  # Sequence object representing the PCR product, i.e. the section of the target
  # sequence contained between the primers (primers included)
  my $amplicon_seq = $primedseq->amplicon();
  print 'Got amplicon sequence: '.$amplicon_seq->seq."\n";
  # Amplicon should be: agctTTTCATTCTGACTgcaac
=head1 DESCRIPTION
This module was created to address the fact that a primer is more than a
SeqFeature and that there is a need to represent the primer-sequence complex and
the attributes that are associated with the complex.
A PrimedSeq object is initialized with a target sequence and two primers. The
location of the primers on the target sequence is calculated if needed so that
one can then get the PCR product, or amplicon sequence. From the PrimedSeq object
you can also retrieve information about melting temperatures and what not on each
of the primers and the amplicon. The L<Bio::Tools::Primer3> module uses PrimedSeq
objects extensively.
Note that this module does not simulate PCR. It assumes that the primers
will match in a single location on the target sequence and does not understand
degenerate primers.
=over
=item *
Providing primers as sequence objects
If the primers are specified as sequence objects, e.g. L<Bio::PrimarySeq> or
L<Bio::Seq>, they are first converted to L<Bio::SeqFeature::Primer> objects.
Their location on the target sequence is then calculated and added to the
L<Bio::SeqFeature::Primer> objects, which you can retrieve using the get_primer()
method.
=item *
Providing primers as primer objects
Because of the limitations of specifying primers as sequence objects, the
recommended method is to provide L<Bio::SeqFeature::Primer> objects. If you did
not record the location of the primers in the primer object, it will be
calculated.
=back
L<Bio::Seq::PrimedSeq> was initially started by Chad Matsalla, and later
improved on by Rob Edwards.
=head1 RECIPES
=over
=item 1.
Run Primer3 to get PrimedSeq objects:
  use Bio::SeqIO;
  use Bio::Tools::Run::Primer3;
  # Read a target sequences from a FASTA file
  my $file = shift || die "Need a file to read";
  my $seqin = Bio::SeqIO->new(-file => $file);
  my $seq = $seqin->next_seq;
  # Use Primer3 to design some primers
  my $primer3 = Bio::Tools::Run::Primer3->new(-seq => $seq);
  my $results = $primer3->run; # default parameters
  # Write all the results in a Genbank file
  my $seqout = Bio::SeqIO->new(-file => ">primed_sequence.gbk", 
                               -format => 'genbank');
  while (my $primedseq = $results->next_primer) {
     $seqout->write_seq( $primedseq->annotated_seq );
  }
=item 2.
Create a genbank file for a sequence and its cognate primers:
  use Bio::SeqIO;
  use Bio::Seq::PrimedSeq;
  # Read a FASTA file that contains the target sequence and its two primers
  my $file = shift || die "$0 <file>";
  my $seqin = Bio::SeqIO->new(-file => $file);
  my ($template, $leftprimer, $rightprimer) = 
        ($seqin->next_seq, $seqin->next_seq, $seqin->next_seq);
  # Set up a PrimedSeq object
  my $primedseq = Bio::Seq::PrimedSeq->new(-seq => $template, 
                                           -left_primer => $leftprimer,
                                           -right_primer => $rightprimer);
  # Write the sequences in an output Genbank file
  my $seqout = Bio::SeqIO->new(-file => ">primed_sequence.gbk",
                               -format => 'genbank');
  $seqout->write_seq($primedseq->annotated_sequence);
=back
=head1 FEEDBACK
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists.  Your participation is much appreciated.
  bioperl-l@bioperl.org                  - General discussion
  http://bioperl.org/wiki/Mailing_lists  - About the mailing lists
=head2 Support 
Please direct usage questions or support issues to the mailing list:
I<bioperl-l@bioperl.org>
rather than to the module maintainer directly. Many experienced and 
reponsive experts will be able look at the problem and quickly 
address it. Please include a thorough description of the problem 
with code and data examples if at all possible.
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution.  Bug reports can be submitted via the
web:
  https://github.com/bioperl/bioperl-live/issues
=head1 AUTHOR
Rob Edwards, redwards@utmem.edu
Based on a module written by Chad Matsalla, bioinformatics1@dieselwurks.com
=head1 APPENDIX
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _
=cut
# Let the code begin...
package Bio::Seq::PrimedSeq;
$Bio::Seq::PrimedSeq::VERSION = '1.7.8';
use strict;
use Bio::SeqFeature::Primer;
use base qw(Bio::Root::Root Bio::SeqFeature::Generic);
# Since this module occupies the Bio::Seq::* namespace, it should probably
# inherit from Bio::Seq before it inherits from Bio::SeqFeature::Generic. But
# then, Bio::SeqI and Bio::SeqFeatureI both request a seq() method that return
# different things. So, being Bio::SeqI is incompatible with being Bio::SeqFeatureI
HideShow 24 lines of Pod
=head2 new
 Title   : new()
 Usage   : my $primedseq = Bio::SeqFeature::Primer->new( 
                            -seq => $sequence,
                            -left_primer => $left_primer,
                            -right_primer => $right_primer
           );
 Function: Construct a primed sequence.
 Returns : A Bio::Seq::PrimedSeq object
 Args    :  -seq => a Bio::Seq object (required)
            -left_primer => a Bio::SeqFeature::Primer or sequence object (required)
            -right_primer => a Bio::SeqFeature::Primer or sequence object (required)
           If you pass a sequence object to specify a primer, it will be used to
           construct a Bio::SeqFeature::Primer that you can retrieve with the
           L<get_primer> method.
           Many other parameters can be included including all of the output
           parameters from the primer3 program (see L<Bio::Tools::Primer3>). At
           the moment these parameters will simply be stored and do anything.
=cut
sub new {
    my($class,%args) = @_;
    my $self = $class->SUPER::new(%args);
    # Need an amplicon sequence
    $self->{seq} = delete $args{-seq} || delete $args{-target_sequence} ||
        $self->throw("Need to provide a sequence during PrimedSeq object construction");
    if (! ref($self->{seq}) || ! $self->{seq}->isa('Bio::SeqI') ) {
        $self->throw("The target_sequence must be a Bio::Seq to create this object.");
    }
    # Need a left and right primers
    for my $primer ( 'left', 'right' ) {
        $self->{$primer} = delete $args{'-'.$primer.'_primer'} ||
            $self->throw("Need to provide both primers during PrimedSeq object construction");
        if ( ref $self->{$primer} && $self->{$primer}->isa('Bio::PrimarySeqI') ) {
            # Convert Bio::Seq or Bio::PrimarySeq objects to Bio::SeqFeature::Primer
            $self->{$primer} = Bio::SeqFeature::Primer->new(-seq => $self->{$primer});
        }
        if (not (ref $self->{$primer} && $self->{$primer}->isa("Bio::SeqFeature::Primer"))) {
            $self->throw("Primers must be Bio::SeqFeature::Primer objects but got a ".ref($self->{$primer}));
        }
    }
    # Save remaining arguments
    while (my ($arg, $val) = each %args) {
        $self->{$arg} = $val;
    }
    # Determine primer location on target if needed
    if ( not( $self->{'left'}->start  && $self->{'left'}->end &&
              $self->{'right'}->start && $self->{'right'}->end ) ) {
        $self->_place_primers();
    }
    return $self;
}
HideShow 14 lines of Pod
=head2 get_primer
 Title   : get_primer();
 Usage   :  my @primers = $primedseq->get_primer();
              or
            my $primer = $primedseq->get_primer('-left_primer');
 Function: Get the primers associated with the PrimedSeq object.
 Returns : A Bio::SeqFeature::Primer object
 Args    : For the left primer, use: l, left, left_primer or -left_primer
           For the right primer, use: r, right, right_primer or -right_primer
           For both primers [default], use: b, both, both_primers or -both_primers
=cut
sub get_primer {
    my ($self, $arg) = @_;
    if (! defined $arg ) {
        return ($self->{left}, $self->{right});
    } elsif ( $arg =~ /^-?l/ ) {
        # What a cheat, I couldn't be bothered to write all the exact statements!
        # Hah, now you can write 'leprechaun' to get the left primer.
        return $self->{left}
    } elsif ( $arg =~ /^-?r/ ) {
        return $self->{right};
    } elsif ( $arg =~ /^-?b/ ) {
        return ($self->{left}, $self->{right});
    }
}
HideShow 13 lines of Pod
=head2 annotated_sequence
 Title   : annotated_sequence
 Usage   : my $annotated_sequence_object = $primedseq->annotate_sequence();
 Function: Get an annotated sequence object containing the left and right
           primers
 Returns : An annotated sequence object or 0 if not defined.
 Args    : 
 Note    : Use this method to return a sequence object that you can write
           out (e.g. in GenBank format). See the example above.
=cut
sub annotated_sequence {
    my $self = shift;
    my $seq = $self->{'seq'}; ### clone??
    $seq->add_SeqFeature($self->{'left'});
    $seq->add_SeqFeature($self->{'right'});
    return $seq;
}
HideShow 13 lines of Pod
=head2 amplicon
 Title   : amplicon
 Usage   : my $amplicon = $primedseq->amplicon();
 Function: Retrieve the amplicon as a sequence object. The amplicon sequnce is
           only the section of the target sequence between the primer matches
           (primers included).
 Returns : A Bio::Seq object. To get the sequence use $amplicon->seq
 Args    : None
 Note    : 
=cut
sub amplicon {
    my ($self) = @_;
    my $left   = $self->{left};
    my $right  = $self->{right};
    my $target = $self->{seq};
    return Bio::PrimarySeq->new(
        -id  => 'Amplicon_from_'.($target->id || 'unidentified'),
        -seq => lc( $left->seq->seq ).
                uc( $target->subseq($left->end+1, $right->start-1) ).
                lc( $right->seq->revcom->seq ),
    );
}
HideShow 11 lines of Pod
=head2 seq
 Title   : seq
 Usage   : my $seqobj = $primedseq->seq();
 Function: Retrieve the target sequence as a sequence object
 Returns : A seq object. To get the sequence use $seqobj->seq
 Args    : None
 Note    : 
=cut
sub seq {
    my $self = shift;
    return $self->{seq};
}
HideShow 12 lines of Pod
=head2 _place_primers
 Title   : _place_primers
 Usage   : $self->_place_primers();
 Function: An internal method to place the primers on the sequence and 
           set up the ranges of the sequences
 Returns : Nothing
 Args    : None
 Note    : Internal use only
=cut
sub _place_primers {
    my $self = shift;
    # Get the target and primer sequence strings, all in uppercase
    my $left  = $self->{left};
    my $right = $self->{right};
    my $target_seq = uc $self->{seq}->seq();
    my $left_seq   = uc $left->seq()->seq();
    my $right_seq  = uc $right->seq()->revcom()->seq();
    # Locate primers on target sequence
    my ($before, $middle, $after) = ($target_seq =~ /^(.*)$left_seq(.*)$right_seq(.*)$/);
    if (not defined $before || not defined $middle || not defined $after) {
        if ($target_seq !~ /$left_seq/) {
            $self->throw("Could not place left primer on target");
        }
        if ($target_seq !~ /$right_seq/) {
            $self->throw("Could not place right primer on target")
        }
    }
    # Save location information in primer object
    my $left_location  = length($before) + 1;
    my $right_location = length($target_seq) - length($after);
    $left->start($left_location);
    $left->end($left_location + $left->seq->length - 1);
    $left->strand(1);
    $right->start($right_location - $right->seq->length + 1);
    $right->end($right_location);
    $right->strand(-1);
    # If Primer3 information was recorded, compare it to what we calculated
    if ( exists($left->{PRIMER_LEFT}) || exists($right->{PRIMER_RIGHT}) || exists($self->{PRIMER_PRODUCT_SIZE}) ) {
        # Bio::Seq::PrimedSeq positions
        my $amplicon_size  = length($left_seq) + length($middle) + length($right_seq);
        $left_location  = $left_location.','.length($left_seq);
        $right_location = $right_location.','.length($right_seq);
  
        # Primer3 positions
        my $primer_product = $self->{PRIMER_PRODUCT_SIZE};
        my $primer_left    = $left->{PRIMER_LEFT};
        my $primer_right   = $right->{PRIMER_RIGHT};
        if ( defined($primer_left) && (not $primer_left eq $left_location) ) {
            $self->warn("Got |$primer_left| from primer3 but calculated ".
                "|$left_location| for the left primer.");
        }
        if ( defined($primer_right) && (not $primer_right eq $right_location) ) {
            $self->warn("Got |$primer_right| from primer3 but calculated ".
                "|$right_location| for the right primer.");
        }
        if ( defined($primer_product) && (not $primer_product eq $amplicon_size) ) {
            $self->warn("Got |$primer_product| from primer3 but calculated ".
                "|$amplicon_size| for the size.");
        }
    }
}
1;