NAME

Bio::Grep::Benchmarks - Bio::Grep Benchmarks

DESCRIPTION

A collection of quick and dirty benchmarks.

BENCHMARKS

2 x Intel(R) Xeon(TM) CPU 2.40GHz, 1GB RAM. Fedora Core 8.

TAIR8_cdna_20080412 (Arabidopsis CDNA Fasta file, 63MB).

Bio::Grep 0.10.5.

Database Generation

Average over 2 iterations.

GUUGle         : 6.29 sec
Agrep/RE       : 18.50 sec
Vmatch (-pl 3) : 208.14 sec

Mismatches

Query: ugacagaagagagugagcac (revcom)

Average over 20 iterations.

No mismatches (exact matching):

Agrep (Wu-Manber):  0.62 sec
Vmatch           :  2.27 sec
RE               :  2.17 sec
Vmatch (-online) :  5.09 sec
GUUGle           : 16.21 sec
Agrep (TRE)      : 15.96 sec

Note that Vmatch needs one slow run to load the suffix arrays in memory (Values are the average over 20 iterations). Also note that GUUGle allows GU mismatches.

One mismatch:

Vmatch           :  0.08 sec
Agrep (Wu-Manber):  1.31 sec
Vmatch (-online) :  5.53 sec
Agrep (TRE)      : 47.01 sec
GUUGle           :       n/a
RE               :       n/a

Two mismatches:

Vmatch           :  0.23 sec
Agrep (Wu-Manber):  1.66 sec
Vmatch (-online) :  6.01 sec
Agrep (TRE)      : 59.17 sec
GUUGle           :       n/a
RE               :       n/a

Three mismatches:

Vmatch           :  0.54 sec
Agrep (Wu-Manber):  2.13 sec
Vmatch (-online) :  6.34 sec
Agrep (TRE)      : 72.56 sec
GUUGle           :       n/a
RE               :       n/a

Four mismatches:

Vmatch           :  1.77 sec
Agrep (Wu-Manber):  2.49 sec
Vmatch (-online) :  7.22 sec
Agrep (TRE)      : 83.50 sec
GUUGle           :       n/a
RE               :       n/a

Five mismatches:

Agrep (Wu-Manber):  3.32 sec
Vmatch           :  7.49 sec
Vmatch (-online) : 11.68 sec
Agrep (TRE)      : 96.16 sec
GUUGle           :       n/a
RE               :       n/a

FEEDBACK

The script that generated these benchmarks is available in the examples directory of this distribution.

Please report any bugs, feature requests and benchmarks to bug-bio-grep@rt.cpan.org, or through the web interface at http://rt.cpan.org.

AUTHOR

Markus Riester, <mriester@gmx.de>

LICENCE AND COPYRIGHT

Copyright (C) 2007-2008 by M. Riester.

This module is free software; you can redistribute it and/or modify it under the same terms as Perl itself.