NAME
Bio::Phylo::Matrices::Sequence - The molecular sequence object.
SYNOPSIS
use Bio::Phylo::Matrices::Sequence;
use Bio::Phylo::Matrices::Alignment;
use Bio::Phylo::Taxa::Taxon;
#instantiating a sequence object...
my $sequence = Bio::Phylo::Matrices::Sequence->new;
$sequence->set_type('DNA');
$sequence->set_seq('ACGCATCGACTCAGAC');
#...and linking it to a taxon object
$sequence->set_taxon(Bio::Phylo::Taxa::Taxon->new( -name => 'Homo_sapiens' ));
#instantiate an alignment object...
my $alignment = Bio::Phylo::Matrices::Alignment->new;
#...and insert the sequence into the alignment
$alignment->insert($sequence);
DESCRIPTION
The sequence object models a character sequence, which can be crossreferenced with a taxon object, and inserted in an alignment object.
METHODS
CONSTRUCTOR
- new()
-
Type : Constructor Title : new Usage : my $sequence = Bio::Phylo::Matrices::Sequence->new; Function: Instantiates a Bio::Phylo::Matrices::Sequence object. Returns : A Bio::Phylo::Matrices::Sequence object. Args : Optional arguments: -type => 'DNA', (a string) -seq => 'ACGCATCGACTACGCAG', (a string) -taxon => $taxon (a Bio::Phylo::Taxa::Taxon object)
MUTATORS
- set_taxon()
-
Type : Mutator Title : set_taxon Usage : $sequence->set_taxon($taxon); Function: Assigns the taxon a sequence refers to. Returns : Modified Bio::Phylo::Matrices::Sequence object. Args : $taxon must be a Bio::Phylo::Taxa::Taxon object. - set_type()
-
Type : Mutator Title : set_type Usage : $sequence->set_type($type); Function: Assigns a sequence's type. Returns : Modified object. Args : $type must be one of [DNA|RNA|STANDARD|PROTEIN| NUCLEOTIDE|CONTINUOUS]. If DNA, RNA or NUCLEOTIDE is defined, the subsequently set seq is validated against the IUPAC nucleotide one letter codes. If PROTEIN is defined, the seq is validated against IUPAC one letter amino acid codes. Likewise, a STANDARD seq has to be a single integer [0-9], while for CONTINUOUS all of Perl's number formats are allowed. - set_seq()
-
Type : Mutator Title : set_seq Usage : $sequence->set_seq('ACGTCGGATCGATCGACACA'); Function: Assigns a character string to the sequence object. Returns : The modified Bio::Phylo::Matrices::Sequence object. Args : A character string. Comments: The string argument is checked against the allowed ranges for the various character types: IUPAC nucleotide (for types of DNA|RNA| NUCLEOTIDE), IUPAC single letter amino acid codes (for type PROTEIN), integers (STANDARD) or any of perl's decimal formats (CONTINUOUS). The character type must be specified first using the $sequence->set_type method.
ACCESSORS
- get_taxon()
-
Type : Accessor Title : get_taxon Usage : my $taxon = $sequence->get_taxon; Function: Retrieves the taxon a sequence refers to. Returns : Bio::Phylo::Taxa::Taxon Args : NONE - get_type()
-
Type : Accessor Title : get_type Usage : my $type = $sequence->get_type; Function: Retrieves a sequence's type. Returns : One of [DNA|RNA|STANDARD|PROTEIN|NUCLEOTIDE|CONTINUOUS] Args : NONE - get_seq()
-
Type : Accessor Title : get_seq Usage : my $string = $sequence->get_char; Function: Retrieves a sequence object's raw character string; Returns : A character string. Args : NONE
SEE ALSO
- Bio::Phylo
-
This object inherits from Bio::Phylo, so the methods defined therein are also applicable to Bio::Phylo::Matrices::Sequence objects.
- Bio::Phylo::Manual
-
Also see the manual: Bio::Phylo::Manual.
FORUM
CPAN hosts a discussion forum for Bio::Phylo. If you have trouble using this module the discussion forum is a good place to start posting questions (NOT bug reports, see below): http://www.cpanforum.com/dist/Bio-Phylo
BUGS
Please report any bugs or feature requests to bug-bio-phylo@rt.cpan.org, or through the web interface at http://rt.cpan.org/NoAuth/ReportBug.html?Queue=Bio-Phylo. I will be notified, and then you'll automatically be notified of progress on your bug as I make changes. Be sure to include the following in your request or comment, so that I know what version you're using:
$Id: Sequence.pm,v 1.9 2005/09/29 20:31:18 rvosa Exp $
AUTHOR
Rutger A. Vos,
- email:
rvosa@sfu.ca - web page: http://www.sfu.ca/~rvosa/
ACKNOWLEDGEMENTS
The author would like to thank Jason Stajich for many ideas borrowed from BioPerl http://www.bioperl.org, and CIPRES http://www.phylo.org and FAB* http://www.sfu.ca/~fabstar for comments and requests.
COPYRIGHT & LICENSE
Copyright 2005 Rutger A. Vos, All Rights Reserved. This program is free software; you can redistribute it and/or modify it under the same terms as Perl itself.