Sponsoring The Perl Toolchain Summit 2025: Help make this important event another success Learn more

NAME

Bio::Tools::CodonOptTable - A more elaborative way to check the codons quality

VERSION

Version 0.01

SYNOPSIS

We produces each codon frequency, Relative Synonymous Codons Uses and Relative Adaptiveness of a Codon table and bar graph

that will help you to calculate the Codon Adaptation Index (CAI) of a gene, to see the gene expression level.

Perhaps a little code snippet.

my $seqobj = Bio::Tools::CodonOptTable->new ( -seq => 'ATGGGGTGGGCACCATGCTGCTGTCGTGAATTTGGGCACGATGGTGTACGTGCTCGTAGCTAGGGTGGGTGGTTTG',
-id => 'GeneFragment-12',
-accession_number => 'Myseq1',
-alphabet => 'dna',
-is_circular => 1
);
#If you wanna read from file
my $seqobj = Bio::Tools::CodonOptTable->new(-file => "contig.fasta",
-format => 'Fasta');
#If you have Accession number and want to get file from NCBI
my $seqobj = Bio::Tools::CodonOptTable->new(-ncbi_id => "J00522");
my $myCodons = $seqobj->rscu_rac_table();
if($myCodons)
{
for my $a (@$myCodons)
{
print "Codon : ",$each_aa->[1]->{'codon'},"\t";
print "Frequency : ",$each_aa->[1]->{'frequency'},"\t";
print "AminoAcid : ",$each_aa->[1]->{'aa_name'},"\t";
print "RSCU Value : ",$each_aa->[1]->{'rscu'},"\t"; #Relative Synonymous Codons Uses
print "RAC Value : ",$each_aa->[1]->{'rac'},"\t"; #Relative Adaptiveness of a Codon
print "\n";
}
}
# to produce a graph between RSCU & RAC
# Graph output file extension should be GIF, we support GIF only
$seqobj->generate_graph($myCodons,"myoutput.gif");
...

METHODS

Title : new
Usage1 : $seq = Bio::Tools::CodonOptTable->new( -seq => 'ATGGGGGTGGTGGTACCCT',
-id => 'human_id',
-accession_number => 'AL000012',
);
Usage2 : $seq = Bio::Tools::CodonOptTable->new( -file => 'myseq.fasta',
-format => 'fasta',
);
Usage3 : $seq = Bio::Tools::CodonOptTable->new( -ncbi_id => 'J00522');
Function: Returns a new primary seq object from
basic constructors, being a string for the sequence
and strings for id and accession_number.
Returns : a new Bio::PrimarySeq object
Args : -seq => sequence string
-display_id => display id of the sequence (locus name)
-accession_number => accession number
-primary_id => primary id (Genbank id)
-desc => description text
-alphabet => molecule type (dna,rna,protein)
-id => alias for display id
-file => file location
-format => file format
-ncbi_id => NCBI accession number
Note : IF you are reading sequence from file it will call _read_localfile method
IF you are fetching file form NCBI it will call _read_remotefile method

METHODS

Title : calculate_rscu
Function: Calculate the RSCU(Relative Synonymous Codons Uses).
Note : The formula is used in the following references.

METHODS

Title : calculate_rac
Function: Calculate the RAC(Relative Adaptiveness of a Codon).
Note : The formula is used in the following references.

METHODS

Title : generate_graph
Function: Produce a bar graph between RAC(Relative Adaptiveness of a Codon) & RSCU(Relative Synonymous Codons Uses).

AUTHOR

Rakesh Kumar Shardiwal, <rakesh.shardiwal at gmail.com>

BUGS

Please report any bugs or feature requests to bug-bio-tools-codonopttable at rt.cpan.org, or through the web interface at http://rt.cpan.org/NoAuth/ReportBug.html?Queue=Bio-Tools-CodonOptTable. I will be notified, and then you'll automatically be notified of progress on your bug as I make changes.

SUPPORT

You can find documentation for this module with the perldoc command.

perldoc Bio::Tools::CodonOptTable

You can also look for information at:

ACKNOWLEDGEMENTS

Lalchand Kumawat <lalchand82@gmail.com> Rajneesh Kumar Sharma <biorajneesh@gmail.com>

COPYRIGHT & LICENSE

Copyright 2008 Rakesh Kumar Shardiwal, all rights reserved.

This program is free software; you can redistribute it and/or modify it under the same terms as Perl itself.