NAME

Bio::Grep::Benchmarks - Bio::Grep Benchmarks

DESCRIPTION

A collection of quick and dirty benchmarks.

BENCHMARKS

[% cpuinfo %], 4GB RAM. [% osname %]. Perl [% perl %].

[% filenameCDNA %] (Arabidopsis CDNA Fasta file, 63MB).

Bio::Grep [% biogrepv %].

Database Generation

Average over [% iterationsdb %] iterations.

GUUGle         : [% guugle_dbgen %] sec
Agrep/RE       : [% agrep_dbgen  %] sec
Vmatch (-pl 3) : [% vmatch_dbgen %] sec

Mismatches

Query: ugacagaagagagugagcac (revcom)

Average over [% iterations %] iterations.

No mismatches (exact matching):

Agrep (Wu-Manber):  [%  agrep_mm_0_0 %] sec
Vmatch           :  [% vmatch_mm_0_0 %] sec
RE               :  [%     re_mm_0_0 %] sec
Vmatch (-online) :  [% vmatch_mm_0_1 %] sec
GUUGle           : [% guugle_mm_0_0 %] sec
Agrep (TRE)      : [% agrep_tre_mm_0_0 %] sec

Note that Vmatch needs one slow run to load the suffix arrays in memory (Values are the average over [% iterations %] iterations). Also note that GUUGle allows GU mismatches.

One mismatch:

Vmatch           :  [% vmatch_mm_1_0 %] sec
Agrep (Wu-Manber):  [%  agrep_mm_1_0 %] sec
Vmatch (-online) :  [% vmatch_mm_1_1 %] sec
Agrep (TRE)      :  [% agrep_tre_mm_1_0 %] sec
GUUGle           :       n/a
RE               :       n/a

Two mismatches:

Vmatch           :  [% vmatch_mm_2_0 %] sec
Agrep (Wu-Manber):  [%  agrep_mm_2_0 %] sec
Vmatch (-online) :  [% vmatch_mm_2_1 %] sec
Agrep (TRE)      :  [% agrep_tre_mm_2_0 %] sec
GUUGle           :       n/a
RE               :       n/a

Three mismatches:

Vmatch           :  [% vmatch_mm_3_0 %] sec
Agrep (Wu-Manber):  [%  agrep_mm_3_0 %] sec
Vmatch (-online) :  [% vmatch_mm_3_1 %] sec
Agrep (TRE)      :  [% agrep_tre_mm_3_0 %] sec
GUUGle           :       n/a
RE               :       n/a

Four mismatches:

Vmatch           :  [% vmatch_mm_4_0 %] sec
Agrep (Wu-Manber):  [%  agrep_mm_4_0 %] sec
Vmatch (-online) :  [% vmatch_mm_4_1 %] sec
Agrep (TRE)      :  [% agrep_tre_mm_4_0 %] sec
GUUGle           :       n/a
RE               :       n/a

Five mismatches:

Agrep (Wu-Manber):  [%  agrep_mm_5_0 %] sec
Vmatch           :  [% vmatch_mm_5_0 %] sec
Vmatch (-online) :  [% vmatch_mm_5_1 %] sec
Agrep (TRE)      :  [% agrep_tre_mm_5_0 %] sec
GUUGle           :       n/a
RE               :       n/a

FEEDBACK

The script that generated these benchmarks is available in the examples directory of this distribution.

Please report any bugs, feature requests and benchmarks to bug-bio-grep@rt.cpan.org, or through the web interface at http://rt.cpan.org.

AUTHOR

Markus Riester, <mriester@gmx.de>

LICENSE AND COPYRIGHT

Copyright (C) 2007-2009 M. Riester.

This module is free software; you can redistribute it and/or modify it under the same terms as Perl itself.