NAME
MCE::Relay - Extends Many-Core Engine with relay capabilities
VERSION
This document describes MCE::Relay version 1.810
SYNOPSIS
use MCE::Flow;
my $file = shift || \*STDIN;
## Line Count #######################################
mce_flow_f {
max_workers => 4,
use_slurpio => 1,
init_relay => 0,
},
sub {
my ($mce, $slurp_ref, $chunk_id) = @_;
my $line_count = ($$slurp_ref =~ tr/\n//);
## Receive and pass on updated information.
my $lines_read = MCE::relay { $_ += $line_count };
}, $file;
my $total_lines = MCE->relay_final;
print {*STDERR} "$total_lines\n";
## Orderly Action ###################################
$| = 1; # Important, must flush output immediately.
mce_flow_f {
max_workers => 2,
use_slurpio => 1,
init_relay => 0,
},
sub {
my ($mce, $slurp_ref, $chunk_id) = @_;
## The relay value is relayed and remains 0.
## Writes to STDOUT orderly.
MCE->relay_lock;
print $$slurp_ref;
MCE->relay_unlock;
}, $file;
DESCRIPTION
This module enables workers to receive and pass on information orderly with zero involvement by the manager process while running. The module is loaded automatically when MCE option init_relay is specified.
All workers (belonging to task_id 0) must participate when relaying data.
Relaying is not meant for passing big data. The last worker will stall if exceeding the buffer size for the socket. Not exceeding 16 KiB - 7 is safe across all platforms.
API DOCUMENTATION
- MCE->relay ( sub { code } )
- MCE::relay { code }
-
Relay is enabled by specifying the init_relay option which takes a hash or array reference, or a scalar value. Relaying is orderly and driven by chunk_id when processing data, otherwise task_wid. Omitting the code block (e.g. MCE::relay) relays forward.
Below, relaying multiple values via a HASH reference.
use MCE::Flow max_workers => 4; mce_flow { init_relay => { p => 0, e => 0 }, }, sub { my $wid = MCE->wid; ## do work my $pass = $wid % 3; my $errs = $wid % 2; ## relay my %last_rpt = MCE::relay { $_->{p} += $pass; $_->{e} += $errs }; MCE->print("$wid: passed $pass, errors $errs\n"); return; }; my %results = MCE->relay_final; print " passed $results{p}, errors $results{e} final\n\n"; -- Output 1: passed 1, errors 1 2: passed 2, errors 0 3: passed 0, errors 1 4: passed 1, errors 0 passed 4, errors 2 finalOr multiple values via an ARRAY reference.
use MCE::Flow max_workers => 4; mce_flow { init_relay => [ 0, 0 ], }, sub { my $wid = MCE->wid; ## do work my $pass = $wid % 3; my $errs = $wid % 2; ## relay my @last_rpt = MCE::relay { $_->[0] += $pass; $_->[1] += $errs }; MCE->print("$wid: passed $pass, errors $errs\n"); return; }; my ($pass, $errs) = MCE->relay_final; print " passed $pass, errors $errs final\n\n"; -- Output 1: passed 1, errors 1 2: passed 2, errors 0 3: passed 0, errors 1 4: passed 1, errors 0 passed 4, errors 2 finalOr simply a scalar value.
use MCE::Flow max_workers => 4; mce_flow { init_relay => 0, }, sub { my $wid = MCE->wid; ## do work my $bytes_read = 1000 + ((MCE->wid % 3) * 3); ## relay my $last_offset = MCE::relay { $_ += $bytes_read }; ## output MCE->print("$wid: $bytes_read\n"); return; }; my $total = MCE->relay_final; print " $total size\n\n"; -- Output 1: 1003 2: 1006 3: 1000 4: 1003 4012 size - MCE->relay_final ( void )
-
Call this method to obtain the final relay value(s) after running. See included example findnull.pl for another use case.
use MCE max_workers => 4; my $mce = MCE->new( init_relay => [ 0, 100 ], ## initial values (two counters) user_func => sub { my ($mce) = @_; ## do work my ($acc1, $acc2) = (10, 20); ## relay to next worker MCE::relay { $_->[0] += $acc1; $_->[1] += $acc2 }; return; } )->run; my ($cnt1, $cnt2) = $mce->relay_final; print "$cnt1 : $cnt2\n"; -- Output 40 : 180 - MCE->relay_recv ( void )
-
Call this method to obtain the next relay value before relaying. This allows serial-code to be processed orderly between workers. The following is a parallel demonstration for the fasta-benchmark on the web.
# perl fasta.pl 25000000 # The Computer Language Benchmarks game # http://benchmarksgame.alioth.debian.org/ # # contributed by Barry Walsh # port of fasta.rb #6 # # MCE::Flow version by Mario Roy # requires MCE 1.807+ # requires MCE::Shared 1.806+ use strict; use warnings; use feature 'say'; use MCE::Flow; use MCE::Shared; use MCE::Candy; use constant IM => 139968; use constant IA => 3877; use constant IC => 29573; my $LAST = MCE::Shared->scalar( 42 ); my $alu = 'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' . 'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' . 'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' . 'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' . 'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' . 'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' . 'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA'; my $iub = [ [ 'a', 0.27 ], [ 'c', 0.12 ], [ 'g', 0.12 ], [ 't', 0.27 ], [ 'B', 0.02 ], [ 'D', 0.02 ], [ 'H', 0.02 ], [ 'K', 0.02 ], [ 'M', 0.02 ], [ 'N', 0.02 ], [ 'R', 0.02 ], [ 'S', 0.02 ], [ 'V', 0.02 ], [ 'W', 0.02 ], [ 'Y', 0.02 ] ]; my $homosapiens = [ [ 'a', 0.3029549426680 ], [ 'c', 0.1979883004921 ], [ 'g', 0.1975473066391 ], [ 't', 0.3015094502008 ] ]; sub make_repeat_fasta { my ( $src, $n ) = @_; my $width = qr/(.{1,60})/; my $l = length $src; my $s = $src x ( ($n / $l) + 1 ); substr( $s, $n, $l ) = ''; while ( $s =~ m/$width/g ) { say $1 } } sub make_random_fasta { my ( $table, $n ) = @_; my $rand = undef; my $width = 60; my $prob = 0.0; my $output = ''; my ( $c1, $c2, $last ); $_->[1] = ( $prob += $_->[1] ) for @$table; $c1 = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;'; $c1 .= "\$output .= '$_->[0]', next if $_->[1] > \$rand;\n" for @$table; my $seq = MCE::Shared->sequence( { chunk_size => 2000, bounds_only => 1 }, 1, $n / $width ); my $code1 = q{ while ( 1 ) { # -------------------------------------------- # Process code orderly between workers. # -------------------------------------------- my $chunk_id = MCE->relay_recv; my ( $begin, $end ) = $seq->next; MCE->relay, last if ( !defined $begin ); my $last = $LAST->get; my $temp = $last; # Pre-compute $LAST value for the next worker for ( 1 .. ( $end - $begin + 1 ) * $width ) { $temp = ( $temp * IA + IC ) % IM; } $LAST->set( $temp ); # Increment chunk_id value MCE->relay( sub { $_ += 1 } ); # -------------------------------------------- # Also run code in parallel between workers. # -------------------------------------------- for ( $begin .. $end ) { for ( 1 .. $width ) { !C! } $output .= "\n"; } # -------------------------------------------- # Display orderly. # -------------------------------------------- MCE->gather( $chunk_id, $output ); $output = ''; } }; $code1 =~ s/!C!/$c1/g; MCE::Flow->init( max_workers => 4, ## MCE::Util->get_ncpu || 4, gather => MCE::Candy::out_iter_fh( \*STDOUT ), init_relay => 1, use_threads => 0, ); MCE::Flow->run( sub { eval $code1 } ); MCE::Flow->finish; $last = $LAST->get; $c2 = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;'; $c2 .= "print('$_->[0]'), next if $_->[1] > \$rand;\n" for @$table; my $code2 = q{ if ( $n % $width != 0 ) { for ( 1 .. $n % $width ) { !C! } print "\n"; } }; $code2 =~ s/!C!/$c2/g; eval $code2; $LAST->set( $last ); } my $n = $ARGV[0] || 27; say ">ONE Homo sapiens alu"; make_repeat_fasta( $alu, $n * 2 ); say ">TWO IUB ambiguity codes"; make_random_fasta( $iub, $n * 3 ); say ">THREE Homo sapiens frequency"; make_random_fasta( $homosapiens, $n * 5 ); - MCE->relay_lock ( void )
- MCE->relay_unlock ( void )
-
The
relay_lockandrelay_unlockmethods, added to MCE 1.807, are aliases forrelay_recvandrelayrespectively. They allow one to perform an exclusive action prior to actual relaying of data.Below,
user_funcis taken from thecat.plMCE example. Relaying is driven bychunk_idortask_widwhen not processing input, thus occurs orderly.user_func => sub { my ($mce, $chunk_ref, $chunk_id) = @_; if ($n_flag) { ## Relays the total lines read. my $output = ''; my $line_count = ($$chunk_ref =~ tr/\n//); my $lines_read = MCE::relay { $_ += $line_count }; open my $fh, '<', $chunk_ref; $output .= sprintf "%6d\t%s", ++$lines_read, $_ while (<$fh>); close $fh; $output .= ":$chunk_id"; MCE->do('display_chunk', $output); } else { ## The following is another way to have ordered output. Workers ## write directly to STDOUT exclusively without any involvement ## from the manager process. The statement(s) between relay_lock ## and relay_unlock run serially and most important orderly. MCE->relay_lock; # alias for MCE->relay_recv print $$chunk_ref; # ensure $| = 1 in script MCE->relay_unlock; # alias for MCE->relay } return; }The following is a variant of the fasta-benchmark demonstration shown above. Here, workers write exclusively and orderly to
STDOUT.# perl fasta.pl 25000000 # The Computer Language Benchmarks game # http://benchmarksgame.alioth.debian.org/ # # contributed by Barry Walsh # port of fasta.rb #6 # # MCE::Flow version by Mario Roy # requires MCE 1.807+ # requires MCE::Shared 1.806+ use strict; use warnings; use feature 'say'; use MCE::Flow; use MCE::Shared; use constant IM => 139968; use constant IA => 3877; use constant IC => 29573; my $LAST = MCE::Shared->scalar( 42 ); my $alu = 'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' . 'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' . 'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' . 'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' . 'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' . 'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' . 'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA'; my $iub = [ [ 'a', 0.27 ], [ 'c', 0.12 ], [ 'g', 0.12 ], [ 't', 0.27 ], [ 'B', 0.02 ], [ 'D', 0.02 ], [ 'H', 0.02 ], [ 'K', 0.02 ], [ 'M', 0.02 ], [ 'N', 0.02 ], [ 'R', 0.02 ], [ 'S', 0.02 ], [ 'V', 0.02 ], [ 'W', 0.02 ], [ 'Y', 0.02 ] ]; my $homosapiens = [ [ 'a', 0.3029549426680 ], [ 'c', 0.1979883004921 ], [ 'g', 0.1975473066391 ], [ 't', 0.3015094502008 ] ]; sub make_repeat_fasta { my ( $src, $n ) = @_; my $width = qr/(.{1,60})/; my $l = length $src; my $s = $src x ( ($n / $l) + 1 ); substr( $s, $n, $l ) = ''; while ( $s =~ m/$width/g ) { say $1 } } sub make_random_fasta { my ( $table, $n ) = @_; my $rand = undef; my $width = 60; my $prob = 0.0; my $output = ''; my ( $c1, $c2, $last ); $_->[1] = ( $prob += $_->[1] ) for @$table; $c1 = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;'; $c1 .= "\$output .= '$_->[0]', next if $_->[1] > \$rand;\n" for @$table; my $seq = MCE::Shared->sequence( { chunk_size => 2000, bounds_only => 1 }, 1, $n / $width ); my $code1 = q{ $| = 1; # Important, must flush output immediately. while ( 1 ) { # -------------------------------------------- # Process code orderly between workers. # -------------------------------------------- MCE->relay_lock; my ( $begin, $end ) = $seq->next; print( $output ), $output = '' if ( length $output ); MCE->relay_unlock, last if ( !defined $begin ); my $last = $LAST->get; my $temp = $last; # Pre-compute $LAST value for the next worker for ( 1 .. ( $end - $begin + 1 ) * $width ) { $temp = ( $temp * IA + IC ) % IM; } $LAST->set( $temp ); MCE->relay_unlock; # -------------------------------------------- # Also run code in parallel. # -------------------------------------------- for ( $begin .. $end ) { for ( 1 .. $width ) { !C! } $output .= "\n"; } } }; $code1 =~ s/!C!/$c1/g; MCE::Flow->init( max_workers => 4, ## MCE::Util->get_ncpu || 4, init_relay => 0, use_threads => 0, ); MCE::Flow->run( sub { eval $code1 } ); MCE::Flow->finish; $last = $LAST->get; $c2 = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;'; $c2 .= "print('$_->[0]'), next if $_->[1] > \$rand;\n" for @$table; my $code2 = q{ if ( $n % $width != 0 ) { for ( 1 .. $n % $width ) { !C! } print "\n"; } }; $code2 =~ s/!C!/$c2/g; eval $code2; $LAST->set( $last ); } my $n = $ARGV[0] || 27; say ">ONE Homo sapiens alu"; make_repeat_fasta( $alu, $n * 2 ); say ">TWO IUB ambiguity codes"; make_random_fasta( $iub, $n * 3 ); say ">THREE Homo sapiens frequency"; make_random_fasta( $homosapiens, $n * 5 );
INDEX
AUTHOR
Mario E. Roy, <marioeroy AT gmail DOT com>